ID: 1042075895

View in Genome Browser
Species Human (GRCh38)
Location 8:64994249-64994271
Sequence GTAAGAGGATTCTGTAAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042075895_1042075904 19 Left 1042075895 8:64994249-64994271 CCGGCCTTACAGAATCCTCTTAC No data
Right 1042075904 8:64994291-64994313 ATGGAAGCTGGGTGAAGGCAGGG No data
1042075895_1042075901 8 Left 1042075895 8:64994249-64994271 CCGGCCTTACAGAATCCTCTTAC No data
Right 1042075901 8:64994280-64994302 CCTCTACGAGAATGGAAGCTGGG No data
1042075895_1042075898 0 Left 1042075895 8:64994249-64994271 CCGGCCTTACAGAATCCTCTTAC No data
Right 1042075898 8:64994272-64994294 TACTATTACCTCTACGAGAATGG No data
1042075895_1042075899 7 Left 1042075895 8:64994249-64994271 CCGGCCTTACAGAATCCTCTTAC No data
Right 1042075899 8:64994279-64994301 ACCTCTACGAGAATGGAAGCTGG No data
1042075895_1042075902 14 Left 1042075895 8:64994249-64994271 CCGGCCTTACAGAATCCTCTTAC No data
Right 1042075902 8:64994286-64994308 CGAGAATGGAAGCTGGGTGAAGG No data
1042075895_1042075903 18 Left 1042075895 8:64994249-64994271 CCGGCCTTACAGAATCCTCTTAC No data
Right 1042075903 8:64994290-64994312 AATGGAAGCTGGGTGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042075895 Original CRISPR GTAAGAGGATTCTGTAAGGC CGG (reversed) Intergenic
No off target data available for this crispr