ID: 1042075898

View in Genome Browser
Species Human (GRCh38)
Location 8:64994272-64994294
Sequence TACTATTACCTCTACGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042075896_1042075898 -4 Left 1042075896 8:64994253-64994275 CCTTACAGAATCCTCTTACTACT No data
Right 1042075898 8:64994272-64994294 TACTATTACCTCTACGAGAATGG No data
1042075895_1042075898 0 Left 1042075895 8:64994249-64994271 CCGGCCTTACAGAATCCTCTTAC No data
Right 1042075898 8:64994272-64994294 TACTATTACCTCTACGAGAATGG No data
1042075894_1042075898 4 Left 1042075894 8:64994245-64994267 CCTGCCGGCCTTACAGAATCCTC No data
Right 1042075898 8:64994272-64994294 TACTATTACCTCTACGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042075898 Original CRISPR TACTATTACCTCTACGAGAA TGG Intergenic
No off target data available for this crispr