ID: 1042075903

View in Genome Browser
Species Human (GRCh38)
Location 8:64994290-64994312
Sequence AATGGAAGCTGGGTGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042075896_1042075903 14 Left 1042075896 8:64994253-64994275 CCTTACAGAATCCTCTTACTACT No data
Right 1042075903 8:64994290-64994312 AATGGAAGCTGGGTGAAGGCAGG No data
1042075895_1042075903 18 Left 1042075895 8:64994249-64994271 CCGGCCTTACAGAATCCTCTTAC No data
Right 1042075903 8:64994290-64994312 AATGGAAGCTGGGTGAAGGCAGG No data
1042075894_1042075903 22 Left 1042075894 8:64994245-64994267 CCTGCCGGCCTTACAGAATCCTC No data
Right 1042075903 8:64994290-64994312 AATGGAAGCTGGGTGAAGGCAGG No data
1042075897_1042075903 3 Left 1042075897 8:64994264-64994286 CCTCTTACTACTATTACCTCTAC No data
Right 1042075903 8:64994290-64994312 AATGGAAGCTGGGTGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042075903 Original CRISPR AATGGAAGCTGGGTGAAGGC AGG Intergenic
No off target data available for this crispr