ID: 1042088168

View in Genome Browser
Species Human (GRCh38)
Location 8:65131407-65131429
Sequence TCACCTTTTTAGTTGATTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042088168_1042088171 15 Left 1042088168 8:65131407-65131429 CCCTGAATCAACTAAAAAGGTGA No data
Right 1042088171 8:65131445-65131467 GTCCCACCTCCAAATTCATCAGG No data
1042088168_1042088170 -7 Left 1042088168 8:65131407-65131429 CCCTGAATCAACTAAAAAGGTGA No data
Right 1042088170 8:65131423-65131445 AAGGTGATAATCTCATGTTTAGG No data
1042088168_1042088172 16 Left 1042088168 8:65131407-65131429 CCCTGAATCAACTAAAAAGGTGA No data
Right 1042088172 8:65131446-65131468 TCCCACCTCCAAATTCATCAGGG No data
1042088168_1042088177 24 Left 1042088168 8:65131407-65131429 CCCTGAATCAACTAAAAAGGTGA No data
Right 1042088177 8:65131454-65131476 CCAAATTCATCAGGGTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042088168 Original CRISPR TCACCTTTTTAGTTGATTCA GGG (reversed) Intergenic