ID: 1042088416

View in Genome Browser
Species Human (GRCh38)
Location 8:65132777-65132799
Sequence CTCTGTGCACAGATCAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042088416_1042088421 20 Left 1042088416 8:65132777-65132799 CCTTCCTTGATCTGTGCACAGAG No data
Right 1042088421 8:65132820-65132842 GATCCTTTAAGCTAGATTGCTGG No data
1042088416_1042088419 -2 Left 1042088416 8:65132777-65132799 CCTTCCTTGATCTGTGCACAGAG No data
Right 1042088419 8:65132798-65132820 AGTCATTGCCGCAGGATGTGAGG No data
1042088416_1042088423 29 Left 1042088416 8:65132777-65132799 CCTTCCTTGATCTGTGCACAGAG No data
Right 1042088423 8:65132829-65132851 AGCTAGATTGCTGGCCAGTTTGG No data
1042088416_1042088418 -10 Left 1042088416 8:65132777-65132799 CCTTCCTTGATCTGTGCACAGAG No data
Right 1042088418 8:65132790-65132812 GTGCACAGAGTCATTGCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042088416 Original CRISPR CTCTGTGCACAGATCAAGGA AGG (reversed) Intergenic
No off target data available for this crispr