ID: 1042092342

View in Genome Browser
Species Human (GRCh38)
Location 8:65172539-65172561
Sequence AAGCTTTGCAGCTTCCACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042092342_1042092351 30 Left 1042092342 8:65172539-65172561 CCCAAGTGGAAGCTGCAAAGCTT No data
Right 1042092351 8:65172592-65172614 CCATCTCGGATTCAAGAGGGAGG No data
1042092342_1042092349 27 Left 1042092342 8:65172539-65172561 CCCAAGTGGAAGCTGCAAAGCTT No data
Right 1042092349 8:65172589-65172611 AGGCCATCTCGGATTCAAGAGGG No data
1042092342_1042092345 16 Left 1042092342 8:65172539-65172561 CCCAAGTGGAAGCTGCAAAGCTT No data
Right 1042092345 8:65172578-65172600 GCAAATCCCTAAGGCCATCTCGG No data
1042092342_1042092344 7 Left 1042092342 8:65172539-65172561 CCCAAGTGGAAGCTGCAAAGCTT No data
Right 1042092344 8:65172569-65172591 ATTGCTTAAGCAAATCCCTAAGG No data
1042092342_1042092348 26 Left 1042092342 8:65172539-65172561 CCCAAGTGGAAGCTGCAAAGCTT No data
Right 1042092348 8:65172588-65172610 AAGGCCATCTCGGATTCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042092342 Original CRISPR AAGCTTTGCAGCTTCCACTT GGG (reversed) Intergenic
No off target data available for this crispr