ID: 1042096773

View in Genome Browser
Species Human (GRCh38)
Location 8:65224783-65224805
Sequence GAGCACTAAATAATAAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042096769_1042096773 17 Left 1042096769 8:65224743-65224765 CCTTGTGGGTTTCTCTTACATTT No data
Right 1042096773 8:65224783-65224805 GAGCACTAAATAATAAGGAAAGG No data
1042096768_1042096773 30 Left 1042096768 8:65224730-65224752 CCTGAGGATCTCTCCTTGTGGGT No data
Right 1042096773 8:65224783-65224805 GAGCACTAAATAATAAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042096773 Original CRISPR GAGCACTAAATAATAAGGAA AGG Intergenic
No off target data available for this crispr