ID: 1042100564

View in Genome Browser
Species Human (GRCh38)
Location 8:65271510-65271532
Sequence GTGAAGATGAAAAAGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042100560_1042100564 -10 Left 1042100560 8:65271497-65271519 CCTCCAGGCTACAGTGAAGATGA No data
Right 1042100564 8:65271510-65271532 GTGAAGATGAAAAAGGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042100564 Original CRISPR GTGAAGATGAAAAAGGAGGA CGG Intergenic
No off target data available for this crispr