ID: 1042102154

View in Genome Browser
Species Human (GRCh38)
Location 8:65285084-65285106
Sequence CAGAGGAGGGGGCCCCCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042102154_1042102162 12 Left 1042102154 8:65285084-65285106 CCAGGCGGGGGCCCCCTCCTCTG No data
Right 1042102162 8:65285119-65285141 ACCCTGTACTCTCTGGTCACAGG No data
1042102154_1042102160 5 Left 1042102154 8:65285084-65285106 CCAGGCGGGGGCCCCCTCCTCTG No data
Right 1042102160 8:65285112-65285134 TCCTAGCACCCTGTACTCTCTGG No data
1042102154_1042102167 17 Left 1042102154 8:65285084-65285106 CCAGGCGGGGGCCCCCTCCTCTG No data
Right 1042102167 8:65285124-65285146 GTACTCTCTGGTCACAGGGGTGG No data
1042102154_1042102164 13 Left 1042102154 8:65285084-65285106 CCAGGCGGGGGCCCCCTCCTCTG No data
Right 1042102164 8:65285120-65285142 CCCTGTACTCTCTGGTCACAGGG No data
1042102154_1042102166 14 Left 1042102154 8:65285084-65285106 CCAGGCGGGGGCCCCCTCCTCTG No data
Right 1042102166 8:65285121-65285143 CCTGTACTCTCTGGTCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042102154 Original CRISPR CAGAGGAGGGGGCCCCCGCC TGG (reversed) Intergenic
No off target data available for this crispr