ID: 1042103645

View in Genome Browser
Species Human (GRCh38)
Location 8:65300617-65300639
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042103645_1042103646 10 Left 1042103645 8:65300617-65300639 CCAATTGCTTTACATACATTAAT No data
Right 1042103646 8:65300650-65300672 CTTACAAAACCCTATGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042103645 Original CRISPR ATTAATGTATGTAAAGCAAT TGG (reversed) Intergenic
No off target data available for this crispr