ID: 1042103646

View in Genome Browser
Species Human (GRCh38)
Location 8:65300650-65300672
Sequence CTTACAAAACCCTATGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042103644_1042103646 28 Left 1042103644 8:65300599-65300621 CCATGTACTGGCAGTATTCCAAT No data
Right 1042103646 8:65300650-65300672 CTTACAAAACCCTATGAGACAGG No data
1042103645_1042103646 10 Left 1042103645 8:65300617-65300639 CCAATTGCTTTACATACATTAAT No data
Right 1042103646 8:65300650-65300672 CTTACAAAACCCTATGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042103646 Original CRISPR CTTACAAAACCCTATGAGAC AGG Intergenic
No off target data available for this crispr