ID: 1042105820

View in Genome Browser
Species Human (GRCh38)
Location 8:65325508-65325530
Sequence CCTCTTCAGTACCCTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042105816_1042105820 19 Left 1042105816 8:65325466-65325488 CCCTGGTGGTATCATACTGAACA No data
Right 1042105820 8:65325508-65325530 CCTCTTCAGTACCCTGAGGAAGG No data
1042105817_1042105820 18 Left 1042105817 8:65325467-65325489 CCTGGTGGTATCATACTGAACAG No data
Right 1042105820 8:65325508-65325530 CCTCTTCAGTACCCTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042105820 Original CRISPR CCTCTTCAGTACCCTGAGGA AGG Intergenic
No off target data available for this crispr