ID: 1042117626

View in Genome Browser
Species Human (GRCh38)
Location 8:65449434-65449456
Sequence CTCATTAATCCCCCCAAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042117626_1042117632 23 Left 1042117626 8:65449434-65449456 CCCCACTTGGGGGGATTAATGAG No data
Right 1042117632 8:65449480-65449502 TGTTCTCTGAGTCAGGAAAATGG No data
1042117626_1042117631 16 Left 1042117626 8:65449434-65449456 CCCCACTTGGGGGGATTAATGAG No data
Right 1042117631 8:65449473-65449495 AATTACATGTTCTCTGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042117626 Original CRISPR CTCATTAATCCCCCCAAGTG GGG (reversed) Intergenic
No off target data available for this crispr