ID: 1042117634

View in Genome Browser
Species Human (GRCh38)
Location 8:65449504-65449526
Sequence TTTCAAGGTCATGCACCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042117634_1042117642 29 Left 1042117634 8:65449504-65449526 CCTACTGGTGCATGACCTTGAAA No data
Right 1042117642 8:65449556-65449578 AATTATGAAGCCCAAAAAGGAGG No data
1042117634_1042117641 26 Left 1042117634 8:65449504-65449526 CCTACTGGTGCATGACCTTGAAA No data
Right 1042117641 8:65449553-65449575 CACAATTATGAAGCCCAAAAAGG No data
1042117634_1042117643 30 Left 1042117634 8:65449504-65449526 CCTACTGGTGCATGACCTTGAAA No data
Right 1042117643 8:65449557-65449579 ATTATGAAGCCCAAAAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042117634 Original CRISPR TTTCAAGGTCATGCACCAGT AGG (reversed) Intergenic
No off target data available for this crispr