ID: 1042117638

View in Genome Browser
Species Human (GRCh38)
Location 8:65449519-65449541
Sequence GTTTGCGTCCCCTCATTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042117638_1042117645 21 Left 1042117638 8:65449519-65449541 CCTTGAAATGAGGGGACGCAAAC No data
Right 1042117645 8:65449563-65449585 AAGCCCAAAAAGGAGGGGCTCGG No data
1042117638_1042117641 11 Left 1042117638 8:65449519-65449541 CCTTGAAATGAGGGGACGCAAAC No data
Right 1042117641 8:65449553-65449575 CACAATTATGAAGCCCAAAAAGG No data
1042117638_1042117646 22 Left 1042117638 8:65449519-65449541 CCTTGAAATGAGGGGACGCAAAC No data
Right 1042117646 8:65449564-65449586 AGCCCAAAAAGGAGGGGCTCGGG No data
1042117638_1042117644 16 Left 1042117638 8:65449519-65449541 CCTTGAAATGAGGGGACGCAAAC No data
Right 1042117644 8:65449558-65449580 TTATGAAGCCCAAAAAGGAGGGG No data
1042117638_1042117647 23 Left 1042117638 8:65449519-65449541 CCTTGAAATGAGGGGACGCAAAC No data
Right 1042117647 8:65449565-65449587 GCCCAAAAAGGAGGGGCTCGGGG No data
1042117638_1042117643 15 Left 1042117638 8:65449519-65449541 CCTTGAAATGAGGGGACGCAAAC No data
Right 1042117643 8:65449557-65449579 ATTATGAAGCCCAAAAAGGAGGG No data
1042117638_1042117642 14 Left 1042117638 8:65449519-65449541 CCTTGAAATGAGGGGACGCAAAC No data
Right 1042117642 8:65449556-65449578 AATTATGAAGCCCAAAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042117638 Original CRISPR GTTTGCGTCCCCTCATTTCA AGG (reversed) Intergenic
No off target data available for this crispr