ID: 1042117643

View in Genome Browser
Species Human (GRCh38)
Location 8:65449557-65449579
Sequence ATTATGAAGCCCAAAAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042117638_1042117643 15 Left 1042117638 8:65449519-65449541 CCTTGAAATGAGGGGACGCAAAC No data
Right 1042117643 8:65449557-65449579 ATTATGAAGCCCAAAAAGGAGGG No data
1042117634_1042117643 30 Left 1042117634 8:65449504-65449526 CCTACTGGTGCATGACCTTGAAA No data
Right 1042117643 8:65449557-65449579 ATTATGAAGCCCAAAAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042117643 Original CRISPR ATTATGAAGCCCAAAAAGGA GGG Intergenic
No off target data available for this crispr