ID: 1042118442

View in Genome Browser
Species Human (GRCh38)
Location 8:65458037-65458059
Sequence CCTGCTTTGCAGGCCTTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042118442_1042118447 -5 Left 1042118442 8:65458037-65458059 CCAGACAAGGCCTGCAAAGCAGG No data
Right 1042118447 8:65458055-65458077 GCAGGAAGGGCAAGCCAAGTAGG No data
1042118442_1042118451 3 Left 1042118442 8:65458037-65458059 CCAGACAAGGCCTGCAAAGCAGG No data
Right 1042118451 8:65458063-65458085 GGCAAGCCAAGTAGGGGAGAGGG No data
1042118442_1042118450 2 Left 1042118442 8:65458037-65458059 CCAGACAAGGCCTGCAAAGCAGG No data
Right 1042118450 8:65458062-65458084 GGGCAAGCCAAGTAGGGGAGAGG No data
1042118442_1042118449 -3 Left 1042118442 8:65458037-65458059 CCAGACAAGGCCTGCAAAGCAGG No data
Right 1042118449 8:65458057-65458079 AGGAAGGGCAAGCCAAGTAGGGG No data
1042118442_1042118448 -4 Left 1042118442 8:65458037-65458059 CCAGACAAGGCCTGCAAAGCAGG No data
Right 1042118448 8:65458056-65458078 CAGGAAGGGCAAGCCAAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042118442 Original CRISPR CCTGCTTTGCAGGCCTTGTC TGG (reversed) Intergenic
No off target data available for this crispr