ID: 1042118605

View in Genome Browser
Species Human (GRCh38)
Location 8:65459688-65459710
Sequence CAGGAGCCCCGATATTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042118605_1042118613 8 Left 1042118605 8:65459688-65459710 CCCTGTGAATATCGGGGCTCCTG No data
Right 1042118613 8:65459719-65459741 ATGGGCCATAAGAACCTAATGGG No data
1042118605_1042118609 -10 Left 1042118605 8:65459688-65459710 CCCTGTGAATATCGGGGCTCCTG No data
Right 1042118609 8:65459701-65459723 GGGGCTCCTGTGGCCTGAATGGG No data
1042118605_1042118612 7 Left 1042118605 8:65459688-65459710 CCCTGTGAATATCGGGGCTCCTG No data
Right 1042118612 8:65459718-65459740 AATGGGCCATAAGAACCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042118605 Original CRISPR CAGGAGCCCCGATATTCACA GGG (reversed) Intergenic
No off target data available for this crispr