ID: 1042120724

View in Genome Browser
Species Human (GRCh38)
Location 8:65485302-65485324
Sequence GCCTGGTGGTGCATGCCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042120724_1042120730 10 Left 1042120724 8:65485302-65485324 CCTACAGGCATGCACCACCAGGC No data
Right 1042120730 8:65485335-65485357 TTTTGTATTTTTGTAGAGACGGG No data
1042120724_1042120731 11 Left 1042120724 8:65485302-65485324 CCTACAGGCATGCACCACCAGGC No data
Right 1042120731 8:65485336-65485358 TTTGTATTTTTGTAGAGACGGGG No data
1042120724_1042120732 29 Left 1042120724 8:65485302-65485324 CCTACAGGCATGCACCACCAGGC No data
Right 1042120732 8:65485354-65485376 CGGGGTTTCACATGTTGCCCAGG No data
1042120724_1042120729 9 Left 1042120724 8:65485302-65485324 CCTACAGGCATGCACCACCAGGC No data
Right 1042120729 8:65485334-65485356 TTTTTGTATTTTTGTAGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042120724 Original CRISPR GCCTGGTGGTGCATGCCTGT AGG (reversed) Intergenic