ID: 1042120727

View in Genome Browser
Species Human (GRCh38)
Location 8:65485319-65485341
Sequence TACAAAAACTTAGCCAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042120727_1042120732 12 Left 1042120727 8:65485319-65485341 CCAGGCCTGGCTAAGTTTTTGTA No data
Right 1042120732 8:65485354-65485376 CGGGGTTTCACATGTTGCCCAGG No data
1042120727_1042120730 -7 Left 1042120727 8:65485319-65485341 CCAGGCCTGGCTAAGTTTTTGTA No data
Right 1042120730 8:65485335-65485357 TTTTGTATTTTTGTAGAGACGGG No data
1042120727_1042120733 16 Left 1042120727 8:65485319-65485341 CCAGGCCTGGCTAAGTTTTTGTA No data
Right 1042120733 8:65485358-65485380 GTTTCACATGTTGCCCAGGCTGG No data
1042120727_1042120729 -8 Left 1042120727 8:65485319-65485341 CCAGGCCTGGCTAAGTTTTTGTA No data
Right 1042120729 8:65485334-65485356 TTTTTGTATTTTTGTAGAGACGG No data
1042120727_1042120731 -6 Left 1042120727 8:65485319-65485341 CCAGGCCTGGCTAAGTTTTTGTA No data
Right 1042120731 8:65485336-65485358 TTTGTATTTTTGTAGAGACGGGG No data
1042120727_1042120736 30 Left 1042120727 8:65485319-65485341 CCAGGCCTGGCTAAGTTTTTGTA No data
Right 1042120736 8:65485372-65485394 CCAGGCTGGTCTTGAACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042120727 Original CRISPR TACAAAAACTTAGCCAGGCC TGG (reversed) Intergenic