ID: 1042120730

View in Genome Browser
Species Human (GRCh38)
Location 8:65485335-65485357
Sequence TTTTGTATTTTTGTAGAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042120722_1042120730 16 Left 1042120722 8:65485296-65485318 CCTCAGCCTACAGGCATGCACCA No data
Right 1042120730 8:65485335-65485357 TTTTGTATTTTTGTAGAGACGGG No data
1042120721_1042120730 23 Left 1042120721 8:65485289-65485311 CCTCTCACCTCAGCCTACAGGCA No data
Right 1042120730 8:65485335-65485357 TTTTGTATTTTTGTAGAGACGGG No data
1042120727_1042120730 -7 Left 1042120727 8:65485319-65485341 CCAGGCCTGGCTAAGTTTTTGTA No data
Right 1042120730 8:65485335-65485357 TTTTGTATTTTTGTAGAGACGGG No data
1042120724_1042120730 10 Left 1042120724 8:65485302-65485324 CCTACAGGCATGCACCACCAGGC No data
Right 1042120730 8:65485335-65485357 TTTTGTATTTTTGTAGAGACGGG No data
1042120726_1042120730 -4 Left 1042120726 8:65485316-65485338 CCACCAGGCCTGGCTAAGTTTTT No data
Right 1042120730 8:65485335-65485357 TTTTGTATTTTTGTAGAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042120730 Original CRISPR TTTTGTATTTTTGTAGAGAC GGG Intergenic