ID: 1042120732

View in Genome Browser
Species Human (GRCh38)
Location 8:65485354-65485376
Sequence CGGGGTTTCACATGTTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042120724_1042120732 29 Left 1042120724 8:65485302-65485324 CCTACAGGCATGCACCACCAGGC No data
Right 1042120732 8:65485354-65485376 CGGGGTTTCACATGTTGCCCAGG No data
1042120726_1042120732 15 Left 1042120726 8:65485316-65485338 CCACCAGGCCTGGCTAAGTTTTT No data
Right 1042120732 8:65485354-65485376 CGGGGTTTCACATGTTGCCCAGG No data
1042120728_1042120732 7 Left 1042120728 8:65485324-65485346 CCTGGCTAAGTTTTTGTATTTTT No data
Right 1042120732 8:65485354-65485376 CGGGGTTTCACATGTTGCCCAGG No data
1042120727_1042120732 12 Left 1042120727 8:65485319-65485341 CCAGGCCTGGCTAAGTTTTTGTA No data
Right 1042120732 8:65485354-65485376 CGGGGTTTCACATGTTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042120732 Original CRISPR CGGGGTTTCACATGTTGCCC AGG Intergenic