ID: 1042120733

View in Genome Browser
Species Human (GRCh38)
Location 8:65485358-65485380
Sequence GTTTCACATGTTGCCCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042120727_1042120733 16 Left 1042120727 8:65485319-65485341 CCAGGCCTGGCTAAGTTTTTGTA No data
Right 1042120733 8:65485358-65485380 GTTTCACATGTTGCCCAGGCTGG No data
1042120728_1042120733 11 Left 1042120728 8:65485324-65485346 CCTGGCTAAGTTTTTGTATTTTT No data
Right 1042120733 8:65485358-65485380 GTTTCACATGTTGCCCAGGCTGG No data
1042120726_1042120733 19 Left 1042120726 8:65485316-65485338 CCACCAGGCCTGGCTAAGTTTTT No data
Right 1042120733 8:65485358-65485380 GTTTCACATGTTGCCCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042120733 Original CRISPR GTTTCACATGTTGCCCAGGC TGG Intergenic