ID: 1042120736

View in Genome Browser
Species Human (GRCh38)
Location 8:65485372-65485394
Sequence CCAGGCTGGTCTTGAACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042120728_1042120736 25 Left 1042120728 8:65485324-65485346 CCTGGCTAAGTTTTTGTATTTTT No data
Right 1042120736 8:65485372-65485394 CCAGGCTGGTCTTGAACTCCTGG No data
1042120727_1042120736 30 Left 1042120727 8:65485319-65485341 CCAGGCCTGGCTAAGTTTTTGTA No data
Right 1042120736 8:65485372-65485394 CCAGGCTGGTCTTGAACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042120736 Original CRISPR CCAGGCTGGTCTTGAACTCC TGG Intergenic