ID: 1042130002

View in Genome Browser
Species Human (GRCh38)
Location 8:65579000-65579022
Sequence CCTGGGCAGGCAGTGTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042129991_1042130002 4 Left 1042129991 8:65578973-65578995 CCAGGCAGGTAGGCAGGTTCTCA No data
Right 1042130002 8:65579000-65579022 CCTGGGCAGGCAGTGTGGTGGGG No data
1042129989_1042130002 11 Left 1042129989 8:65578966-65578988 CCATGGACCAGGCAGGTAGGCAG No data
Right 1042130002 8:65579000-65579022 CCTGGGCAGGCAGTGTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042130002 Original CRISPR CCTGGGCAGGCAGTGTGGTG GGG Intergenic
No off target data available for this crispr