ID: 1042146711

View in Genome Browser
Species Human (GRCh38)
Location 8:65737275-65737297
Sequence GCTTCCACATTAGCGGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042146707_1042146711 22 Left 1042146707 8:65737230-65737252 CCTTATGGCTTTAAGGCTTAATT 0: 1
1: 0
2: 3
3: 48
4: 438
Right 1042146711 8:65737275-65737297 GCTTCCACATTAGCGGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042146711 Original CRISPR GCTTCCACATTAGCGGCAAC AGG Intronic
No off target data available for this crispr