ID: 1042147851

View in Genome Browser
Species Human (GRCh38)
Location 8:65750732-65750754
Sequence CCAGAAAATAAGAGTTAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 304}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042147851 Original CRISPR CCAGAAAATAAGAGTTAGGC AGG (reversed) Intronic
902299483 1:15491771-15491793 CCAAAAAACAAGAAATAGGCTGG + Intronic
903535901 1:24066175-24066197 CAAGAAAAATAGAGTAAGGCAGG - Intronic
904275609 1:29382245-29382267 CCAGAAACTAAGCCTCAGGCGGG - Intergenic
904359927 1:29964523-29964545 TCTGAACATAAGAGTTTGGCTGG + Intergenic
904526054 1:31134828-31134850 CCAGAAAAAAAAAGTATGGCTGG + Intergenic
904554804 1:31353013-31353035 CCAGAAAATAAGTGTTGGCAAGG - Intronic
904733252 1:32611105-32611127 CCAAAAAATTAAAATTAGGCGGG + Intronic
906762642 1:48389975-48389997 CCAGAAAATAACAATATGGCAGG + Intronic
908021016 1:59898793-59898815 CCAGTTATTAATAGTTAGGCAGG - Intronic
910364634 1:86451573-86451595 CCAGAAAATAGGAGGTAATCAGG - Intronic
910535005 1:88287728-88287750 CTAGAAAAACAGAATTAGGCTGG - Intergenic
911218259 1:95218966-95218988 ACAGATAATAAAAGTGAGGCTGG - Intronic
912739805 1:112183574-112183596 GAATAAAATAAGAGTTAAGCGGG - Intergenic
914715763 1:150253769-150253791 CCAAAAAAAAAGAGAGAGGCTGG + Intergenic
915298563 1:154939015-154939037 TCAGAAAATGAGAATGAGGCTGG - Intergenic
915615374 1:157033802-157033824 CCAAAAAATAAAAGCTAGGCTGG - Intronic
916034076 1:160905674-160905696 CCTGAAAACAGGATTTAGGCAGG + Intergenic
916146810 1:161747184-161747206 ACAGAAAATAAGTGTTAGCAAGG - Intergenic
916775406 1:167957778-167957800 ACAGAAAATAAGAGTTGGCAAGG - Intronic
917021448 1:170592944-170592966 ACAGAAAATAAAAGGGAGGCTGG + Intergenic
917118601 1:171626241-171626263 CAAGAAAATAAAAATTAGCCAGG - Intergenic
917563361 1:176183445-176183467 ACAGAAAATAAGAGTTGGCAAGG + Intronic
917692718 1:177485551-177485573 CCAGAAAATAATAATAAGGAAGG - Intergenic
919172222 1:193969256-193969278 CCAGAAAACAAAAATTAGCCAGG + Intergenic
923359381 1:233194718-233194740 CAAGAAAAGAAAAGTTAGGCTGG + Intronic
923973222 1:239228935-239228957 GCAGAAAATTAGGGATAGGCAGG - Intergenic
924684219 1:246270964-246270986 CCAGAAAATAAGTGTTGGGGAGG - Intronic
1065263213 10:23947754-23947776 CTAGAATATAAGCTTTAGGCAGG - Intronic
1065579970 10:27161009-27161031 CCAGAAAAAAAGAGTTACAAAGG - Intronic
1065966733 10:30776665-30776687 CCACAAAATAAGAATTATGCTGG + Intergenic
1066239809 10:33522598-33522620 CCAAAATATAAAAGTTAGCCTGG + Intergenic
1067279910 10:44863423-44863445 CCAGTGAGTATGAGTTAGGCTGG + Intergenic
1067482487 10:46612616-46612638 GCAAAAAAGAAGAGATAGGCCGG + Intergenic
1067612264 10:47729048-47729070 GCAAAAAAGAAGAGATAGGCCGG - Intergenic
1067780384 10:49198596-49198618 CCTTTAAATAAGAGTTTGGCTGG - Intergenic
1067898273 10:50210202-50210224 CCATAAAAAAAGAATGAGGCTGG + Intronic
1068249216 10:54414824-54414846 CCATGATATAAGATTTAGGCTGG + Intronic
1069038960 10:63674468-63674490 CAAAAAAATAACAGTTAGCCAGG + Intergenic
1069445132 10:68466179-68466201 ACAAAAAATAAAAGTTAGCCGGG - Intronic
1069930383 10:71877804-71877826 CCAGAAAAAAAGAGTGATGCTGG - Intergenic
1071627686 10:87189295-87189317 GCAAAAAAGAAGAGATAGGCCGG - Intronic
1074798225 10:116971226-116971248 CCAGTCAAAATGAGTTAGGCTGG + Intronic
1075037714 10:119082942-119082964 CAAAAAAATAAGAGCTGGGCAGG + Intergenic
1078087457 11:8242831-8242853 CCAGAAAACGAGAGTCTGGCAGG + Intronic
1078615246 11:12859226-12859248 CAAGAAATTAAAAGTTAGTCAGG + Intronic
1081253782 11:40868013-40868035 CCAGAAAAAGAGAGCTAGGGAGG + Intronic
1083786308 11:64950031-64950053 CCAGAAAAGAAAGGATAGGCTGG + Intronic
1083850802 11:65365505-65365527 CTAGAAAAGAAAAGATAGGCCGG - Intergenic
1084584215 11:70046918-70046940 ACAAAAAATAAGAATTAGCCAGG + Intergenic
1085676776 11:78528265-78528287 ACAGAATATAAGATTTAGACAGG + Intronic
1085778926 11:79390967-79390989 CAAGCAAACAAGAGTTAGACTGG - Intronic
1085889377 11:80559356-80559378 CCAGAAACTCAAAGGTAGGCAGG - Intergenic
1086458426 11:86982246-86982268 CCCCAAAACAAGAGTCAGGCTGG + Intergenic
1087367745 11:97242630-97242652 TCAGAAAATAAGAGTTGGTGAGG - Intergenic
1088640974 11:111872555-111872577 AAAGAAAAAAAGAGTTAAGCTGG - Intergenic
1089271986 11:117307737-117307759 CCAGTAAAGAAGAGTTTAGCTGG - Intronic
1089837470 11:121383650-121383672 CCAGAGAAGGAGATTTAGGCTGG + Intergenic
1090336007 11:125965640-125965662 CCTAAAAATAAGAGTGAAGCAGG + Intronic
1091191779 11:133701667-133701689 CCAGAAAACAAAAGCTAAGCTGG - Intergenic
1091877663 12:3949633-3949655 TCAGAAAACAAGAATTAGGAAGG - Intergenic
1093797936 12:23336219-23336241 CCATAAAATAAAAGTTAGAAAGG + Intergenic
1096311458 12:50524886-50524908 ACAAAAAATAAAAATTAGGCGGG - Intronic
1096785326 12:54014113-54014135 CCACAAAACAAGAGTTGGCCTGG - Intronic
1097060046 12:56276237-56276259 TCAGCAAAGAAGAATTAGGCAGG + Intronic
1098854556 12:75637537-75637559 AAAGAAAATAAGTGATAGGCAGG - Intergenic
1099152312 12:79129761-79129783 CCAGAAAATCAGGGTTGGGGAGG + Intronic
1099895863 12:88645711-88645733 ATAGAAAATAATAATTAGGCAGG - Intergenic
1100885043 12:99060427-99060449 GCATAAAATAAGAGTTACTCTGG - Intronic
1104090980 12:125517486-125517508 CAAGAAAATATGTGTTGGGCCGG - Intronic
1104362033 12:128142670-128142692 CCAGAAAATTAGTTTCAGGCCGG - Intergenic
1106162164 13:27211341-27211363 CCAGAAAATAAGTGTTGGCAAGG + Intergenic
1106922420 13:34577672-34577694 CCAGAAAAAAAGACTGAGTCAGG + Intergenic
1108754532 13:53484125-53484147 GCTTAAAATAAGAGTTTGGCTGG + Intergenic
1110100800 13:71598547-71598569 TCAAAAAATAAGCGTCAGGCCGG - Intronic
1110534471 13:76635257-76635279 CCAGAAAAGAAGGGTAAGGAAGG + Intergenic
1111433946 13:88181603-88181625 TCAGGAGATAAGAGTTGGGCAGG - Intergenic
1112647432 13:101350398-101350420 CGAGAAAATGATAGTTAAGCTGG - Intronic
1112826040 13:103393505-103393527 CCAGAGAGCAAGTGTTAGGCTGG - Intergenic
1113431915 13:110258240-110258262 CAAGAAAATAAAATTTAAGCCGG + Intronic
1113976371 13:114230844-114230866 TCAGAAAATACGAGTTAGCATGG - Intergenic
1116776806 14:49190665-49190687 CCAGAAAAGAGGAGTTAAGTGGG + Intergenic
1116784931 14:49277213-49277235 CCAGAAAATCTGACTTAGTCAGG - Intergenic
1117021088 14:51571216-51571238 ACAGAAAATAAAAATTAGCCAGG + Intronic
1117539050 14:56729026-56729048 GTTGAAAATAAGATTTAGGCCGG - Intronic
1119056085 14:71421436-71421458 CGAGAAAAAAAAAGGTAGGCAGG + Intronic
1119470761 14:74897066-74897088 CCAGACAATAACATTTGGGCAGG + Intronic
1121390273 14:93567521-93567543 ACAGAAAAGAAAAGTGAGGCCGG - Intronic
1124385542 15:29205467-29205489 CCAGAAAATAAGTGTTGGTGAGG - Intronic
1127917157 15:63464252-63464274 CCAGAAAATAGTAGTGAGGTGGG + Intergenic
1128025133 15:64429371-64429393 TCAGAAAACAAGAATGAGGCTGG - Intronic
1128158595 15:65408330-65408352 CCAGAACAGATGAGCTAGGCAGG - Intronic
1129711254 15:77821204-77821226 TCAGAAAATAAGAATAAGGGAGG + Intergenic
1129983737 15:79897398-79897420 CCAGAAAAGAAGGGCAAGGCAGG + Intronic
1130617632 15:85427249-85427271 CCAGAAAACAATACTAAGGCCGG - Intronic
1131937621 15:97523689-97523711 CCAGATAATATGTGTTAGCCAGG - Intergenic
1132541794 16:513378-513400 CCAAAAAAGAAAAGTTAGCCAGG - Intronic
1133665487 16:7963580-7963602 CCTGACAAAAAGAGTTAAGCAGG + Intergenic
1134885708 16:17789428-17789450 ACAGAAAAACATAGTTAGGCTGG - Intergenic
1135190771 16:20352695-20352717 CCAGAAAGGTAGAGTTAGTCTGG + Exonic
1135462676 16:22658944-22658966 ACAAAAAACAAGAATTAGGCAGG - Intergenic
1135748251 16:25035870-25035892 GCAGTAAATATGAGTCAGGCTGG + Intergenic
1135787654 16:25364829-25364851 CTAAAAAATAAGAGCTAGCCAGG - Intergenic
1135906042 16:26512719-26512741 GAAAAAAATAAGAGGTAGGCAGG + Intergenic
1136677694 16:31927332-31927354 CCAAAAAATAAGATTTATCCAGG - Intergenic
1140038982 16:71392918-71392940 CCAGAAAGGAAGAGTTGTGCAGG + Intergenic
1140288578 16:73628457-73628479 CCAGAAAACAAGAGTCCAGCAGG + Intergenic
1140948273 16:79791588-79791610 CCAGAAGCTAAGAGAAAGGCAGG - Intergenic
1142923274 17:3209814-3209836 GCAGAAAATAAGATTTTGGATGG - Intergenic
1143122828 17:4619630-4619652 CTAAAAAATAAAAATTAGGCCGG - Intergenic
1143245643 17:5483473-5483495 CAAGAAAATAAGTGTTTGGCAGG - Intronic
1145785307 17:27589699-27589721 CCAGAAAAAAAGTGCAAGGCTGG - Intronic
1146041575 17:29459571-29459593 CCATAAAAAAAGAATGAGGCCGG - Intronic
1146514760 17:33480532-33480554 CCAGAAAGCAAGAAATAGGCTGG + Intronic
1146581330 17:34040552-34040574 GCAGAAAGTAAGGGTTAGACAGG + Intronic
1148046591 17:44748638-44748660 CCATAAAACCAGAGCTAGGCAGG - Intronic
1149495348 17:57114010-57114032 CCTGAAAATAAGCAGTAGGCAGG - Intronic
1150348801 17:64425551-64425573 AGAGAAACTAATAGTTAGGCAGG - Intergenic
1151330663 17:73405144-73405166 TTAGAAAATAAAAGTTAGGCTGG + Intronic
1151924039 17:77180528-77180550 CCAGAAAATAAGGCTGAGGTGGG - Intronic
1154999292 18:21670851-21670873 CCAAAAAATACAAGTTAGCCAGG + Intronic
1155677547 18:28447910-28447932 TCAGAAAATAAGAGTTACTTTGG - Intergenic
1156436763 18:37139115-37139137 CAAAAAAATAAAAGTTAGCCAGG - Intronic
1156613222 18:38751906-38751928 CCAGTAAATAAGAGAGGGGCTGG + Intergenic
1156738279 18:40291069-40291091 CCAGAAAATAAGTGTTGGCTGGG + Intergenic
1162081463 19:8220301-8220323 CCAGAAAAGAAGAGAGAGGGAGG - Intronic
1163367803 19:16885749-16885771 TAAGAAAATAAGATTTTGGCCGG + Intergenic
1164181119 19:22819709-22819731 CCTGAAAATAGGTTTTAGGCAGG - Intergenic
1164266774 19:23626277-23626299 TAATAAAATAAAAGTTAGGCTGG + Intronic
1165020550 19:32920778-32920800 CTATAAAATAAGAGGGAGGCTGG - Intronic
1165960991 19:39534003-39534025 ACAGAAAAAAAAAATTAGGCAGG + Intergenic
1166221367 19:41366839-41366861 TCAGAAAATATGATTGAGGCCGG + Intronic
1166553305 19:43681471-43681493 CCAAAAAAGAATAATTAGGCCGG - Intergenic
1167853840 19:52222037-52222059 GCAGGAAATGAGAGTTAGCCAGG + Intronic
1168108059 19:54176282-54176304 CAAGAAAACAAGAGTTGGCCAGG - Intronic
1168222008 19:54967161-54967183 ACAGAAGAAAAGATTTAGGCCGG - Intronic
927546361 2:23957300-23957322 TCAGAAAAAAAAAGTTAGCCAGG - Intronic
928148158 2:28801295-28801317 CTAGAAAATAAGCCTTTGGCAGG + Exonic
929019861 2:37541714-37541736 CCAGAGAATAAGGATTTGGCTGG - Intergenic
930835053 2:55784043-55784065 ACAGAAAAAAGGAGGTAGGCCGG - Intergenic
930920439 2:56746861-56746883 GCAGAAAATGAGAGGTAGGGAGG + Intergenic
931230563 2:60371319-60371341 CTAGAAAATATGAGCTAGGATGG - Intergenic
933845168 2:86319924-86319946 CCAGAAGATAAGAGAAAGGCAGG + Intronic
935957279 2:108389828-108389850 CAGGAAAGTAAGAGGTAGGCTGG - Intergenic
938936875 2:136135014-136135036 CAAAAAAATAAAAGTTAGACGGG - Intergenic
939390606 2:141564467-141564489 AGAGAGAATAAGAGTTGGGCTGG + Intronic
941140666 2:161776835-161776857 CCAGAAAATAAGTGTTGGCAAGG - Intronic
941508822 2:166380290-166380312 CCAGAAAATAAGAGTTTGATAGG + Intergenic
941802681 2:169678042-169678064 ACAGAAATTAAGACTTAGGCTGG + Intronic
943214634 2:185014452-185014474 CCAGAAAATAAGAGGTAAAGAGG + Intergenic
943416280 2:187610036-187610058 CAAAAGAATAAGAGTTAGCCTGG - Intergenic
943458508 2:188139257-188139279 TCTGAAAATATGAGTTAGGAAGG + Intergenic
945382254 2:209154942-209154964 TCAGAAAATAAAAGCTATGCAGG - Intergenic
946993731 2:225366544-225366566 CCAGAAAATAAGTGTTGGTGAGG - Intergenic
947446705 2:230169617-230169639 TAAAAAAATAAGAGTGAGGCTGG - Intronic
1169262003 20:4146064-4146086 CCAGAAGATAGGAGAGAGGCTGG + Intronic
1169399498 20:5267940-5267962 CCAGGAAATAAGAAATATGCAGG - Intergenic
1170708339 20:18766445-18766467 TCAGAAAAGAAGAGGGAGGCCGG + Intergenic
1171355414 20:24541697-24541719 GCAGAAATAAAGAGTCAGGCAGG + Intronic
1172308866 20:33901542-33901564 CCAAAAAAAAAGAATTAGCCAGG - Intergenic
1172403125 20:34667002-34667024 ACAAAAAATAAGAATTAGTCAGG - Intronic
1172746886 20:37217585-37217607 TGAAAAAATAAGATTTAGGCCGG - Intronic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1174258185 20:49274824-49274846 CTAGAAAATAAAAACTAGGCCGG + Intronic
1176661543 21:9639930-9639952 TTAGAAAATAAGAGTCAAGCAGG + Intergenic
1181846648 22:25715349-25715371 ACAAAAAATAAGAATTAGCCAGG + Intronic
1182021237 22:27083374-27083396 CCAGAAAATGAGGGATATGCTGG + Intergenic
1183596690 22:38816971-38816993 ACTGAAAATGAGAGTCAGGCTGG + Intergenic
1184295818 22:43524209-43524231 CCATAAAATAAATTTTAGGCTGG - Intergenic
949966220 3:9358767-9358789 CCAGAAAATATGTGTTACACTGG - Intronic
950058727 3:10051082-10051104 CAAAAAAAAAAGAGTGAGGCCGG + Intronic
950712416 3:14821803-14821825 TAAGAAAATCAGAGTAAGGCCGG + Intronic
951152571 3:19309070-19309092 CCAGAAAATAAGCACTTGGCTGG - Intronic
951510817 3:23500069-23500091 CCAGAAAATCAGACGTAGCCTGG + Intronic
951633580 3:24747651-24747673 TCAAAGAATAAGAGTTAGTCTGG - Intergenic
952160910 3:30692194-30692216 CCAGAAGAGAAGTGCTAGGCAGG - Exonic
952297988 3:32077858-32077880 GCAGAAAAAAAGACTAAGGCAGG - Intergenic
953051211 3:39345710-39345732 CTAGAAAATAAAAAATAGGCTGG + Intergenic
953699140 3:45182531-45182553 TCAAAAAATAAGTGTGAGGCCGG - Intergenic
954183528 3:48899698-48899720 CTAAAAAAAAAAAGTTAGGCCGG + Intergenic
954339776 3:49943869-49943891 ACAGAAAATAAGTGTTGGGGAGG - Intronic
954826947 3:53382126-53382148 CCAGAAAATAAGTGTTAGCAAGG + Intergenic
956563105 3:70604242-70604264 ACAAAAAATAAAAGTTAGCCAGG + Intergenic
956676455 3:71737627-71737649 GAACAAAATAAGAATTAGGCTGG + Intronic
957928221 3:86842543-86842565 TCAGAAAATAGGACTCAGGCTGG - Intergenic
959144360 3:102526013-102526035 TCAGAAAATAAGAATTATGAAGG - Intergenic
959205087 3:103297626-103297648 CCAACAAATAAGAATTCGGCCGG + Intergenic
959447178 3:106454740-106454762 ACAAAAAATAAGAATTAGCCAGG + Intergenic
959736123 3:109660952-109660974 CCAGAAATTAAGAGTTGGGCAGG - Intergenic
959838058 3:110943940-110943962 CCAGAAAAGAGAAGGTAGGCAGG + Intergenic
961905651 3:130260383-130260405 CCAGAATATAAGAGTGAAGAGGG - Intergenic
962328521 3:134456547-134456569 GAAAAAAATAAGAATTAGGCTGG + Intergenic
963032995 3:140997475-140997497 ACTTAAAATAAAAGTTAGGCTGG - Intergenic
963142932 3:141962653-141962675 ACACAAAAGAAGAGTTAGCCAGG - Intronic
964819614 3:160755709-160755731 CCAGAGAATAAAAGTTTTGCGGG - Intronic
964856215 3:161148795-161148817 AGAGAACCTAAGAGTTAGGCAGG + Intronic
965612947 3:170563970-170563992 CTAGAACATAATAGTAAGGCTGG - Intronic
966870228 3:184285443-184285465 CCAGAAAATAAGAAAAGGGCAGG - Intronic
967408156 3:189140217-189140239 CCAGAAAATTAGAGTTGGACAGG + Intronic
967768312 3:193306867-193306889 CCAGAGAATGAAAGTTTGGCAGG + Intronic
969341643 4:6545702-6545724 CCAGCTAACAAGAGTCAGGCAGG - Intronic
970529997 4:16971813-16971835 ACAGAAAATGAGAGATGGGCTGG - Intergenic
970750930 4:19359977-19359999 CCAGACAAGAAGAGTGAGGAAGG + Intergenic
972752128 4:42000554-42000576 CAAGAAAATAAGTTCTAGGCCGG + Intronic
972822015 4:42712909-42712931 CCAGAAACTTAAAATTAGGCAGG + Intergenic
974567805 4:63601009-63601031 ACACAAACTAAGAGCTAGGCTGG - Intergenic
975937970 4:79604739-79604761 AGAGAAAAGAAGAGTTAGGAAGG - Intergenic
976173146 4:82325366-82325388 CAAAAAAATAAAAATTAGGCCGG + Intergenic
976271412 4:83234283-83234305 CAAGAAAATAAAAAATAGGCTGG - Intergenic
978930639 4:114307281-114307303 ACAGAAAATAAAAGTGAGGGAGG + Intergenic
980337257 4:131492582-131492604 CCAGTACATAACAGTTATGCAGG - Intergenic
980504372 4:133695883-133695905 ACAGAAAATAAAAATTAGCCAGG - Intergenic
981215770 4:142165272-142165294 CCAGAAAATAGGCGTTAGTGAGG - Intronic
981588812 4:146333857-146333879 GCAGAAGATTAGAGTGAGGCAGG + Intronic
982032863 4:151317999-151318021 AAAGAAAATAAAAGATAGGCCGG + Intronic
985289985 4:188377172-188377194 CCAAAATATAAAAGTTAGCCAGG + Intergenic
985413852 4:189716617-189716639 TTAGAAAATAAGAGTCAAGCAGG - Intergenic
986136235 5:4981228-4981250 CCAGAAAATTAAAGTGAGGAAGG - Intergenic
986336042 5:6756263-6756285 CCAAAAACTCAGGGTTAGGCAGG - Exonic
990022827 5:51149086-51149108 CCACATAAAATGAGTTAGGCAGG - Intergenic
990063720 5:51685307-51685329 CCATAAAATAAGATTTTGGTGGG + Intergenic
991735643 5:69629564-69629586 CCAGAAAAAAAAAATTAGCCTGG - Intergenic
991812134 5:70485203-70485225 CCAGAAAAAAAAAATTAGCCTGG - Intergenic
992065816 5:73106925-73106947 ACAGAAAATAAGTGTTAGAGAGG - Intergenic
992534584 5:77686186-77686208 CCAGAAGCTAAGAGAAAGGCAGG - Intergenic
992676240 5:79109113-79109135 CCAAAAAATACAAGTTAGCCGGG + Intronic
993198313 5:84779839-84779861 TCAGAGAATAAGAGCTTGGCTGG + Intergenic
996218413 5:120896688-120896710 ACAAAAAATAAAAGTGAGGCAGG - Intergenic
996707249 5:126509985-126510007 CCAGAACATAAAAATTAGCCAGG - Intergenic
997298920 5:132788100-132788122 CAAGAAAATAAGAGTTAGCTGGG - Intronic
997657269 5:135564572-135564594 CAAGAAAATAAAAGTCAGCCAGG - Intergenic
997751333 5:136348707-136348729 ACAGAATATCAGAGGTAGGCAGG - Intronic
997982925 5:138480913-138480935 ATAGAAAATAAAAGTTAGTCTGG - Intergenic
998259326 5:140616880-140616902 ACAAAAAATAAATGTTAGGCAGG + Intergenic
998372058 5:141668265-141668287 ACAAAAAATAAGAATTAGCCAGG - Intronic
998488057 5:142520815-142520837 CCAGATAATATTAATTAGGCCGG + Intergenic
998745413 5:145253142-145253164 CCAGAAAATGAGATTTGGACTGG - Intergenic
999400044 5:151257517-151257539 CCTGGAATTAAGAGTCAGGCTGG - Intronic
999623776 5:153498776-153498798 CTAGAAAATAGAAGTTAAGCAGG - Intronic
999738852 5:154534027-154534049 CTAAAAAATAAAAATTAGGCTGG - Intergenic
999781473 5:154854053-154854075 CAAGAAGAAAAGAATTAGGCCGG - Intronic
1002507958 5:179693375-179693397 ACAAAAAATAAAAATTAGGCTGG + Intronic
1002704824 5:181153529-181153551 ACAGAAAAAAAAAGTTAGCCTGG + Intergenic
1003747839 6:9023267-9023289 CTAGAAGATAAGAGCTAGGCTGG - Intergenic
1004153955 6:13150182-13150204 ACAGAAAATACAAGTTAGCCTGG + Intronic
1004156955 6:13178019-13178041 CCAGAAGAGGAGAGTAAGGCTGG + Intronic
1005457871 6:26038814-26038836 CCATAAAAAAACAGTTTGGCTGG + Intergenic
1006201222 6:32293327-32293349 CAAGAAAAGAAGAGTGAGGCAGG - Exonic
1006864870 6:37201255-37201277 ACAAAAAATAAGAATTAGCCAGG + Intergenic
1006872415 6:37263878-37263900 TAAGAAAAAAAGTGTTAGGCCGG - Intronic
1007031391 6:38630646-38630668 CTAGAATAAAAGAGTTAAGCAGG + Intronic
1007781963 6:44259503-44259525 CCAGAATATCCGAGTTAGGAGGG + Intronic
1008560950 6:52724249-52724271 CCAGAAACCAAGAGAGAGGCTGG - Intergenic
1011606599 6:89112571-89112593 CCAAAAAAAAAAAGTTAGCCGGG - Intronic
1014332991 6:120094737-120094759 CTAGAAAAACAGAGTTAGGCAGG + Intergenic
1014634402 6:123826992-123827014 ACAGAAAATAAGTGTCAGCCAGG - Intronic
1014846861 6:126288289-126288311 CCAGAAAAGAAGAGATACCCTGG - Intergenic
1015021217 6:128478235-128478257 TCAGAAAACAAGAGTTAGGAAGG - Intronic
1015696369 6:135984617-135984639 GTAGAAAATAAGACTTAGACTGG + Intronic
1016956544 6:149632565-149632587 TCAAAAAATAAGATTTAGGTAGG - Intronic
1017440420 6:154459853-154459875 CCAGAAAACAACAGTCAGACGGG + Intronic
1019437462 7:1029420-1029442 CCAAAAATTAAAAATTAGGCTGG - Intronic
1019467442 7:1197158-1197180 CCAAAAAAAAAGAATTAGCCAGG - Intergenic
1021796555 7:24260720-24260742 TTAAAAAATAAGAGTGAGGCTGG + Intergenic
1022374339 7:29799643-29799665 TCAAAAAATAATAGTTAGGCTGG - Intergenic
1022731900 7:33034462-33034484 CAAGAAAATAAGTTTTAGACTGG + Intronic
1023687467 7:42751284-42751306 ACAGAAAATAAAACTCAGGCTGG + Intergenic
1023873481 7:44274958-44274980 ACAGAAAAGAGGAGTGAGGCAGG + Intronic
1024654814 7:51442669-51442691 CAGGAAAATAAGAATTAGGGAGG + Intergenic
1025147242 7:56515416-56515438 CCAGAAAACAAGAGCAAAGCTGG + Intergenic
1027237114 7:76304572-76304594 CTAAAAAATAAAAATTAGGCAGG + Intergenic
1027979214 7:85195725-85195747 CCATAAAAAAAGAGTTAAGAAGG - Intergenic
1028866363 7:95718017-95718039 TCAAAAAATTAAAGTTAGGCTGG - Intergenic
1029264053 7:99324992-99325014 CCAAAAAATAAAAATTAGCCAGG + Intergenic
1029451564 7:100644194-100644216 ACAAAAAATAAAAATTAGGCTGG - Intronic
1030357844 7:108561930-108561952 CCAGAAAGTCAGAGTAAGGATGG + Intronic
1030686948 7:112496779-112496801 CCAGAAAATAAGAGCTGGAATGG + Intergenic
1031663236 7:124453590-124453612 CCAGAAATTAAGTCTTATGCAGG - Intergenic
1034145398 7:148866873-148866895 CCAAAAAATAAAAATTAGCCGGG - Intronic
1035415820 7:158684847-158684869 CTAGAAAATAAAAAATAGGCTGG - Intronic
1036474684 8:9082442-9082464 TCACAAAATGAGAGTTAAGCTGG + Intronic
1036934129 8:12984524-12984546 CCAGGAAAGAAGGTTTAGGCAGG - Intronic
1037182601 8:16025493-16025515 TCAGAAAAAAAGTGTTAGGCTGG - Intergenic
1037422899 8:18722848-18722870 TCAGAAAATTAGAGTTTGGAGGG - Intronic
1038955372 8:32462762-32462784 CCAAAATATAAAAGTTAGCCGGG - Intronic
1040419657 8:47226990-47227012 CCAGAAAATAAGTGTTGGTGAGG - Intergenic
1041900303 8:62975170-62975192 CCTCAAAATATGAGTTAGGGAGG + Intronic
1042147851 8:65750732-65750754 CCAGAAAATAAGAGTTAGGCAGG - Intronic
1042178673 8:66062663-66062685 CCACAAAATTGGAGTGAGGCTGG + Intronic
1043050648 8:75380987-75381009 CCAGAAAATGGGAGGAAGGCTGG + Intergenic
1043311776 8:78869590-78869612 CCAGAAAATAAAAATTAAGATGG - Intergenic
1044007089 8:86951290-86951312 CAAGAATATAATAGATAGGCTGG + Intronic
1044666152 8:94636516-94636538 CCAAAAAAAAAAAGGTAGGCCGG - Intergenic
1044980970 8:97716392-97716414 AAAGAAAAAAAAAGTTAGGCCGG + Intronic
1044981658 8:97722303-97722325 TAAGAATATAAAAGTTAGGCCGG + Intronic
1045341282 8:101256917-101256939 CCAGAAAATAAGAAGTATACTGG + Intergenic
1046540597 8:115576668-115576690 CCAGAAAATAAAATACAGGCAGG + Intronic
1047960993 8:130011519-130011541 TCAAAAAATAAAAATTAGGCTGG + Intronic
1048049413 8:130803229-130803251 GCAGAAAACAAGAGTTAGCCTGG - Intronic
1050444871 9:5710204-5710226 ACAGAATATAGGAGTGAGGCAGG + Intronic
1051246612 9:15118098-15118120 CCAGAAAAGCAGAGTTAGAGTGG + Intergenic
1055143547 9:72904723-72904745 CCAGAGTATAAGAGTCAGGATGG - Intronic
1057311108 9:93943826-93943848 CCAGACAGTGAGAGTTTGGCCGG + Intergenic
1058708951 9:107662239-107662261 ATACAAAATAAGAGATAGGCTGG - Intergenic
1059409783 9:114124713-114124735 CTAGAAAAGAAGACTGAGGCTGG + Intergenic
1059599193 9:115757826-115757848 CCAGTGAATAAGATTTAGGATGG + Intergenic
1059845232 9:118268276-118268298 CCAGAAAAGAGGAGTGAGGGTGG - Intergenic
1060676435 9:125519469-125519491 ACAGAAAATAAAAATTAGCCTGG + Intronic
1060847361 9:126848028-126848050 TCAAAAAATAAAAATTAGGCCGG - Intergenic
1062661130 9:137634107-137634129 CAAGAAAATAAAAATTAGGCCGG - Intronic
1203639106 Un_KI270750v1:141773-141795 TTAGAAAATAAGAGTCAAGCAGG + Intergenic
1185615826 X:1421260-1421282 CAAAAAATTAACAGTTAGGCTGG - Intronic
1186242573 X:7585766-7585788 ACAGAAAATAAGTGTTGGGAAGG - Intergenic
1187697368 X:21935952-21935974 CCAGAAAATAAGTGTTGGTAAGG - Intergenic
1188900385 X:35725332-35725354 CCATAAAATAATAGACAGGCTGG - Intergenic
1189057413 X:37712755-37712777 TCAGTGAATATGAGTTAGGCAGG + Intronic
1189120914 X:38393978-38394000 CTAGAGAATAAGAGAGAGGCAGG - Intronic
1189229074 X:39437924-39437946 ACAGAAAATAGGAGTTAAGGTGG - Intergenic
1189843737 X:45111360-45111382 CCTGAAAATAAAAGTAAGGTAGG - Exonic
1190789018 X:53682742-53682764 CCAGAAACTCAGAGCAAGGCAGG + Intronic
1193716917 X:84944366-84944388 TAAGAAACTAAGAGTTAGGCCGG - Intergenic
1195071847 X:101289006-101289028 ACAGAAAATTTCAGTTAGGCTGG - Intronic
1195086290 X:101417493-101417515 TTAGAAAAAAGGAGTTAGGCTGG - Intergenic
1196181174 X:112691435-112691457 ACAGAAAATAAGTGTTGGGAGGG + Intergenic
1196539558 X:116890582-116890604 CCAGGAGTTAAGAGTTAGACTGG + Intergenic
1199722650 X:150553212-150553234 CCAGAAACTAGGAGAGAGGCCGG + Intergenic
1200358226 X:155574349-155574371 ACAGAAAGTAAGAGTGAGACAGG + Intronic
1200982915 Y:9278610-9278632 CAGGAAAATATGAGTCAGGCTGG - Intergenic
1201678080 Y:16610463-16610485 CCAGAAACTAAGAAAAAGGCTGG + Intergenic