ID: 1042156245

View in Genome Browser
Species Human (GRCh38)
Location 8:65847305-65847327
Sequence CCCTCTCCACTTGTGAGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042156245_1042156250 12 Left 1042156245 8:65847305-65847327 CCCAAGCTCACAAGTGGAGAGGG No data
Right 1042156250 8:65847340-65847362 GATATCTGCTGTGGAGACACAGG No data
1042156245_1042156248 3 Left 1042156245 8:65847305-65847327 CCCAAGCTCACAAGTGGAGAGGG No data
Right 1042156248 8:65847331-65847353 CATCCAGCTGATATCTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042156245 Original CRISPR CCCTCTCCACTTGTGAGCTT GGG (reversed) Intergenic