ID: 1042156250

View in Genome Browser
Species Human (GRCh38)
Location 8:65847340-65847362
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042156243_1042156250 13 Left 1042156243 8:65847304-65847326 CCCCAAGCTCACAAGTGGAGAGG No data
Right 1042156250 8:65847340-65847362 GATATCTGCTGTGGAGACACAGG No data
1042156247_1042156250 11 Left 1042156247 8:65847306-65847328 CCAAGCTCACAAGTGGAGAGGGC No data
Right 1042156250 8:65847340-65847362 GATATCTGCTGTGGAGACACAGG No data
1042156245_1042156250 12 Left 1042156245 8:65847305-65847327 CCCAAGCTCACAAGTGGAGAGGG No data
Right 1042156250 8:65847340-65847362 GATATCTGCTGTGGAGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042156250 Original CRISPR GATATCTGCTGTGGAGACAC AGG Intergenic