ID: 1042166348

View in Genome Browser
Species Human (GRCh38)
Location 8:65949570-65949592
Sequence TCTGTTCAGTAGACAGGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042166348_1042166357 29 Left 1042166348 8:65949570-65949592 CCATACCCTGTCTACTGAACAGA No data
Right 1042166357 8:65949622-65949644 GCAATATTGATGGTGGAATTCGG No data
1042166348_1042166353 7 Left 1042166348 8:65949570-65949592 CCATACCCTGTCTACTGAACAGA No data
Right 1042166353 8:65949600-65949622 TGGGCAACCAGTTGAGTTTCAGG No data
1042166348_1042166355 19 Left 1042166348 8:65949570-65949592 CCATACCCTGTCTACTGAACAGA No data
Right 1042166355 8:65949612-65949634 TGAGTTTCAGGCAATATTGATGG No data
1042166348_1042166358 30 Left 1042166348 8:65949570-65949592 CCATACCCTGTCTACTGAACAGA No data
Right 1042166358 8:65949623-65949645 CAATATTGATGGTGGAATTCGGG No data
1042166348_1042166356 22 Left 1042166348 8:65949570-65949592 CCATACCCTGTCTACTGAACAGA No data
Right 1042166356 8:65949615-65949637 GTTTCAGGCAATATTGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042166348 Original CRISPR TCTGTTCAGTAGACAGGGTA TGG (reversed) Intergenic
No off target data available for this crispr