ID: 1042169484

View in Genome Browser
Species Human (GRCh38)
Location 8:65978011-65978033
Sequence CTGGGTCAGCAGCTGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042169484_1042169491 2 Left 1042169484 8:65978011-65978033 CCCCTCTGCAGCTGCTGACCCAG No data
Right 1042169491 8:65978036-65978058 GCTAAGCCCCTCACTGACCAGGG No data
1042169484_1042169490 1 Left 1042169484 8:65978011-65978033 CCCCTCTGCAGCTGCTGACCCAG No data
Right 1042169490 8:65978035-65978057 TGCTAAGCCCCTCACTGACCAGG No data
1042169484_1042169492 6 Left 1042169484 8:65978011-65978033 CCCCTCTGCAGCTGCTGACCCAG No data
Right 1042169492 8:65978040-65978062 AGCCCCTCACTGACCAGGGCTGG No data
1042169484_1042169498 22 Left 1042169484 8:65978011-65978033 CCCCTCTGCAGCTGCTGACCCAG No data
Right 1042169498 8:65978056-65978078 GGGCTGGTGGCGTCTGCCAGTGG No data
1042169484_1042169495 9 Left 1042169484 8:65978011-65978033 CCCCTCTGCAGCTGCTGACCCAG No data
Right 1042169495 8:65978043-65978065 CCCTCACTGACCAGGGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042169484 Original CRISPR CTGGGTCAGCAGCTGCAGAG GGG (reversed) Intergenic
No off target data available for this crispr