ID: 1042171838

View in Genome Browser
Species Human (GRCh38)
Location 8:65999198-65999220
Sequence TAGAATAAGGAGAAAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042171838_1042171842 15 Left 1042171838 8:65999198-65999220 CCTCCCACTTTCTCCTTATTCTA No data
Right 1042171842 8:65999236-65999258 AAAGATTTCAAAGAAGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042171838 Original CRISPR TAGAATAAGGAGAAAGTGGG AGG (reversed) Intergenic
No off target data available for this crispr