ID: 1042172330

View in Genome Browser
Species Human (GRCh38)
Location 8:66004260-66004282
Sequence AAGCCCTGCTTCACAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042172330_1042172332 20 Left 1042172330 8:66004260-66004282 CCTGTCTTTGTGAAGCAGGGCTT No data
Right 1042172332 8:66004303-66004325 AATGAGATTATGAAGTAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042172330 Original CRISPR AAGCCCTGCTTCACAAAGAC AGG (reversed) Intergenic