ID: 1042172827

View in Genome Browser
Species Human (GRCh38)
Location 8:66008984-66009006
Sequence ACATATCAGCCACAGCTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042172827_1042172829 -8 Left 1042172827 8:66008984-66009006 CCTCCTAGCTGTGGCTGATATGT No data
Right 1042172829 8:66008999-66009021 TGATATGTCTCTCCCTACATTGG No data
1042172827_1042172835 18 Left 1042172827 8:66008984-66009006 CCTCCTAGCTGTGGCTGATATGT No data
Right 1042172835 8:66009025-66009047 CATTTGCCTTGGCTACTCACTGG No data
1042172827_1042172830 -7 Left 1042172827 8:66008984-66009006 CCTCCTAGCTGTGGCTGATATGT No data
Right 1042172830 8:66009000-66009022 GATATGTCTCTCCCTACATTGGG No data
1042172827_1042172833 7 Left 1042172827 8:66008984-66009006 CCTCCTAGCTGTGGCTGATATGT No data
Right 1042172833 8:66009014-66009036 TACATTGGGTCCATTTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042172827 Original CRISPR ACATATCAGCCACAGCTAGG AGG (reversed) Intergenic
No off target data available for this crispr