ID: 1042173008

View in Genome Browser
Species Human (GRCh38)
Location 8:66010513-66010535
Sequence CATTAAGAAGAGCTTGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042173001_1042173008 29 Left 1042173001 8:66010461-66010483 CCTGCACCCTTTGCCTTGACTTC No data
Right 1042173008 8:66010513-66010535 CATTAAGAAGAGCTTGCCCCAGG No data
1042173003_1042173008 22 Left 1042173003 8:66010468-66010490 CCTTTGCCTTGACTTCTCAGTCT No data
Right 1042173008 8:66010513-66010535 CATTAAGAAGAGCTTGCCCCAGG No data
1042173002_1042173008 23 Left 1042173002 8:66010467-66010489 CCCTTTGCCTTGACTTCTCAGTC No data
Right 1042173008 8:66010513-66010535 CATTAAGAAGAGCTTGCCCCAGG No data
1042173005_1042173008 -9 Left 1042173005 8:66010499-66010521 CCTTCCTACTCTACCATTAAGAA No data
Right 1042173008 8:66010513-66010535 CATTAAGAAGAGCTTGCCCCAGG No data
1042173004_1042173008 16 Left 1042173004 8:66010474-66010496 CCTTGACTTCTCAGTCTTTTGTG No data
Right 1042173008 8:66010513-66010535 CATTAAGAAGAGCTTGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042173008 Original CRISPR CATTAAGAAGAGCTTGCCCC AGG Intergenic
No off target data available for this crispr