ID: 1042175006

View in Genome Browser
Species Human (GRCh38)
Location 8:66029919-66029941
Sequence CTTCCAGTTGATATGGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042175000_1042175006 6 Left 1042175000 8:66029890-66029912 CCCCTCAGACATTTGCTTTGGAG 0: 1
1: 0
2: 0
3: 34
4: 216
Right 1042175006 8:66029919-66029941 CTTCCAGTTGATATGGGGCCTGG No data
1042175002_1042175006 4 Left 1042175002 8:66029892-66029914 CCTCAGACATTTGCTTTGGAGAA 0: 1
1: 0
2: 2
3: 30
4: 248
Right 1042175006 8:66029919-66029941 CTTCCAGTTGATATGGGGCCTGG No data
1042175001_1042175006 5 Left 1042175001 8:66029891-66029913 CCCTCAGACATTTGCTTTGGAGA 0: 1
1: 0
2: 1
3: 22
4: 192
Right 1042175006 8:66029919-66029941 CTTCCAGTTGATATGGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042175006 Original CRISPR CTTCCAGTTGATATGGGGCC TGG Intronic
No off target data available for this crispr