ID: 1042180519

View in Genome Browser
Species Human (GRCh38)
Location 8:66082677-66082699
Sequence TATTTAGCAGCTCCTATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042180517_1042180519 8 Left 1042180517 8:66082646-66082668 CCAAAAGGAAAAGCTTTATCTTG 0: 1
1: 0
2: 1
3: 28
4: 373
Right 1042180519 8:66082677-66082699 TATTTAGCAGCTCCTATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042180519 Original CRISPR TATTTAGCAGCTCCTATGCA GGG Intronic
No off target data available for this crispr