ID: 1042187175

View in Genome Browser
Species Human (GRCh38)
Location 8:66148370-66148392
Sequence TATCCAATACTGCCTAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042187175_1042187177 -9 Left 1042187175 8:66148370-66148392 CCATTCTTAGGCAGTATTGGATA 0: 1
1: 0
2: 1
3: 7
4: 109
Right 1042187177 8:66148384-66148406 TATTGGATAAATAGAGGATCTGG No data
1042187175_1042187178 17 Left 1042187175 8:66148370-66148392 CCATTCTTAGGCAGTATTGGATA 0: 1
1: 0
2: 1
3: 7
4: 109
Right 1042187178 8:66148410-66148432 ATACAGATATATGCTATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042187175 Original CRISPR TATCCAATACTGCCTAAGAA TGG (reversed) Intronic
901823357 1:11844611-11844633 TGTGCAACACTGCCTACGAAGGG + Intergenic
902492791 1:16797378-16797400 TATCCAAGGCTTCGTAAGAAAGG - Intronic
911460292 1:98181029-98181051 TATCCTTAACTGCCTATGAAAGG - Intergenic
913474220 1:119221340-119221362 GATCCAATGCTGACTATGAAAGG - Intergenic
915697099 1:157754372-157754394 TATCCAATATGGTCTAAAAAGGG + Intronic
920601988 1:207335995-207336017 TACCCAATACTGCCTCAACAGGG + Intronic
923527657 1:234785154-234785176 TATCCAAGGCTTCGTAAGAAAGG + Intergenic
1068977188 10:63022671-63022693 TACCCTATATAGCCTAAGAAGGG + Intergenic
1073787829 10:106909579-106909601 TATGCATTACTGTCTAAGTAGGG + Intronic
1079170079 11:18085083-18085105 TACCCAATAATGCTTAACAATGG + Intronic
1081769202 11:45636948-45636970 TATCCAAGACTGTGTAATAAAGG - Intergenic
1087475838 11:98633271-98633293 TATCCTATACGGTCTAAAAAGGG + Intergenic
1092779689 12:11974047-11974069 TCTCAAATACTGGCAAAGAAAGG + Intergenic
1093289557 12:17303481-17303503 TATGCAATATTGCCCAATAATGG - Intergenic
1093539012 12:20258312-20258334 TATCCAAGACTGCTTAAGAAAGG - Intergenic
1097524797 12:60718543-60718565 TAGCCAGTACTGGCTGAGAAAGG - Intergenic
1098090901 12:66899986-66900008 TATGCTATCCTGCCCAAGAATGG - Intergenic
1099608310 12:84833553-84833575 TATAATAAACTGCCTAAGAAAGG - Intergenic
1100682278 12:96939480-96939502 TATCCAAAAATGCCCAAGACTGG - Intronic
1102410733 12:112715968-112715990 TATCCTATACAGTCTAAAAATGG - Intronic
1105540690 13:21313740-21313762 TACTCAATGCTGCCTGAGAATGG + Intergenic
1109570961 13:64189122-64189144 TGGCCAACACTGCATAAGAATGG - Intergenic
1110760651 13:79227048-79227070 TGTCCTATTCTGCCTCAGAATGG + Intergenic
1112517859 13:100071039-100071061 TAGCCAATATTGCCTATGACTGG - Intergenic
1118118245 14:62806168-62806190 TATCCAATATGGTCTAAAAAGGG + Intronic
1137342558 16:47623929-47623951 TGTCCTATACTTCTTAAGAATGG + Intronic
1139823142 16:69736545-69736567 TCTCCAGTAGTTCCTAAGAAAGG + Intergenic
1154378126 18:13825632-13825654 GAACCAACACAGCCTAAGAAAGG - Exonic
1155648669 18:28113534-28113556 TATTCTCCACTGCCTAAGAAGGG + Intronic
1157700150 18:49757229-49757251 TATCAAAAACTGCCTAAAAGAGG + Intergenic
1161820744 19:6529324-6529346 CATCCAGCACTTCCTAAGAAGGG - Intergenic
1167718487 19:51160378-51160400 TTTCCAATACTTTCTAAAAAAGG + Intergenic
927032328 2:19134245-19134267 TATACTATACTGCCTATGATTGG - Intergenic
927327423 2:21821116-21821138 TATCCAAGAATCTCTAAGAATGG - Intergenic
928576300 2:32658504-32658526 TATCTAACTCTGCCTAGGAATGG - Intronic
929857078 2:45646501-45646523 TAGCCAATCCTGACTAATAAAGG + Intergenic
937084241 2:119159961-119159983 TATTCAAGACTGGCTCAGAATGG - Intergenic
937711363 2:124984111-124984133 TATCCTATACAGCCTAAAACGGG + Intergenic
940271821 2:151899355-151899377 TATCCAGTACTGCAGAAGGAAGG + Intronic
941017824 2:160377057-160377079 TAAGCTATACTGCCTGAGAATGG + Intronic
944135474 2:196394582-196394604 TCTCCAATCCTGTCTCAGAAAGG + Intronic
945607734 2:211957159-211957181 TAACCCATACTACCTCAGAATGG + Intronic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1169061910 20:2666623-2666645 TGACCAATACTGCCTGATAATGG + Intergenic
1169141855 20:3231046-3231068 TTCCCAATAATGCCTAGGAATGG + Exonic
1169796801 20:9471559-9471581 TATCCAAAACTGACTGAAAATGG + Intronic
1177874981 21:26620835-26620857 TTTCCAATACTGCCTTAAATAGG + Intergenic
1177953479 21:27568166-27568188 TATTTAATGTTGCCTAAGAAAGG + Intergenic
1180718694 22:17890471-17890493 TATTCACTCCTGCCAAAGAAAGG - Intronic
1185347795 22:50318008-50318030 TCTCCAAGGCAGCCTAAGAAGGG + Exonic
953994776 3:47511530-47511552 GATCCAATTCTTCCTAAGACTGG - Intronic
955924628 3:63993219-63993241 TATCCCATATTCCCTAAGAAGGG + Intronic
962810732 3:138957158-138957180 TATGAAGTATTGCCTAAGAATGG - Intergenic
963441797 3:145349182-145349204 TAACCAAAACTGCCTATGAAGGG + Intergenic
964372209 3:156012231-156012253 TTTCTAATACTGCCTAAAATAGG + Intergenic
971412393 4:26388008-26388030 TATCCAGCACTCCCTCAGAAAGG + Intronic
975385809 4:73758900-73758922 TATCCAATAATTCCTAGCAAGGG - Intergenic
976953143 4:90858835-90858857 TATCATTTACTGCCAAAGAAGGG + Intronic
978311561 4:107389774-107389796 TATGAAATACTGCCAAGGAATGG + Intergenic
981332969 4:143533776-143533798 TGTCTAACAGTGCCTAAGAATGG - Intronic
981737243 4:147965764-147965786 TATCCACTAGCACCTAAGAAAGG - Intronic
984727911 4:183039048-183039070 TATCCACTACCAACTAAGAAAGG + Intergenic
987216372 5:15742112-15742134 TATCCAAAACTACTTAATAAGGG + Intronic
987456298 5:18151221-18151243 TATCTACTACTGCCTTAGAAGGG - Intergenic
988125765 5:27033217-27033239 TATCTAATATTGACTAATAAAGG + Intronic
989339387 5:40356037-40356059 TATCCCATACGGTCTAAAAAGGG - Intergenic
990442091 5:55856773-55856795 TATCCAGTACTATCTACGAAAGG - Intronic
995577342 5:113553088-113553110 TTTCCAATATTCCCTAAGGAAGG - Intronic
995906172 5:117126578-117126600 TAACCAAAACAGCCTTAGAAAGG - Intergenic
996925751 5:128824234-128824256 TACCCAATATTGTCTAAAAAGGG + Intronic
1008768060 6:54943720-54943742 TATCCAATACTAACAAAGAATGG - Intergenic
1009884610 6:69610826-69610848 TATAAAAAACTGCCTAAGATTGG - Intergenic
1010984138 6:82402884-82402906 TATAAAATACTGACTTAGAAAGG + Intergenic
1012118078 6:95330166-95330188 TATCTAATGCTGCATAAGAAAGG + Intergenic
1013019023 6:106191980-106192002 TATGCCATACTGCATAAAAATGG - Intronic
1014433441 6:121396196-121396218 TCTCCATTAATGCCCAAGAAAGG + Intergenic
1015296938 6:131605997-131606019 AATACAATACTATCTAAGAATGG + Intronic
1015723504 6:136272472-136272494 CAGCCAATACTGACTTAGAAAGG - Intronic
1016297143 6:142585574-142585596 TACCCTATACGGCCTAAAAAGGG + Intergenic
1020685348 7:11286967-11286989 AATCCGAGACAGCCTAAGAAAGG - Intergenic
1021106587 7:16645600-16645622 TTTTTAATACTCCCTAAGAAAGG - Exonic
1023579711 7:41668662-41668684 TATCTAATAGAGCCTAAGACTGG - Intergenic
1024832327 7:53475376-53475398 TATCCAATACTGTACAAAAAAGG - Intergenic
1025818012 7:64936532-64936554 TATCCTACTCTGCCTCAGAAAGG + Intergenic
1027332869 7:77117818-77117840 TATCCTATACTGCACAAGACAGG + Intergenic
1028662717 7:93299013-93299035 TATACAATACTGCAAAAAAACGG - Intronic
1029782915 7:102753479-102753501 TATCCTATACTGCACAAGACAGG - Intronic
1030671897 7:112347230-112347252 CATCCACTACTGCCAAAAAAAGG + Intergenic
1034209414 7:149349844-149349866 TATCCAAGACTGGGTAATAAAGG + Intergenic
1034827942 7:154283794-154283816 TATCCAATACTGTGTATGGATGG - Intronic
1037067231 8:14597096-14597118 TATCTAAGAATGTCTAAGAATGG - Intronic
1038510282 8:28127714-28127736 TATCAAATCTTGCCTAAGACAGG - Intronic
1039023430 8:33231908-33231930 TATCCAACAGTGCCTAGGAATGG + Intergenic
1039456500 8:37710892-37710914 TCTCCAATACTTTCAAAGAAGGG - Intergenic
1041159989 8:55030576-55030598 TATCCAATACTGTATACAAATGG - Intergenic
1042187175 8:66148370-66148392 TATCCAATACTGCCTAAGAATGG - Intronic
1044896332 8:96896226-96896248 TAACCAATACTCCTTAAGTATGG + Intronic
1045691396 8:104763463-104763485 TATCCTATACGGTCTAAAAAGGG - Intronic
1046012102 8:108561534-108561556 TCTCCAATACCATCTAAGAAAGG - Intergenic
1047266138 8:123310938-123310960 CATCCATTACAGCCTAGGAAAGG + Intergenic
1050210776 9:3253521-3253543 TCTCCAATTCTGCCCAAGAAAGG + Intronic
1051041190 9:12813639-12813661 TTTCCAATAGTGCCAAAAAAAGG + Intronic
1052353450 9:27480719-27480741 TATACAATTCTGCCTAGGCACGG - Intronic
1052778965 9:32760972-32760994 CATAAAATCCTGCCTAAGAATGG - Intergenic
1053591061 9:39515365-39515387 TATCCAATACTATCTAACTATGG - Intergenic
1053848908 9:42270737-42270759 TATCCAATACTATCTAACTATGG - Intergenic
1054575245 9:66849925-66849947 TATCCAATACTATCTAACTATGG + Intergenic
1054875537 9:70092544-70092566 GACCCAAGACTGCCTAAGTAGGG + Intronic
1057445120 9:95108472-95108494 TGTCCAATAATCCCTAAGATGGG + Intronic
1061721787 9:132556516-132556538 TTTCAAAAACTGCCTGAGAAAGG - Intronic
1185661880 X:1734972-1734994 TAGCAAATGCTGCCTGAGAACGG - Intergenic
1187499745 X:19829922-19829944 TACCCTATACTGTCTAAAAAGGG - Intronic
1188338295 X:28966589-28966611 TATACAATACTGGCCATGAAAGG - Intronic
1189795756 X:44644758-44644780 TATCACATGCAGCCTAAGAAGGG + Intergenic
1189824982 X:44908783-44908805 CAGCCAATACTTCCTAAAAATGG - Intronic
1194702205 X:97128230-97128252 TATCCTATACGGTCTAAAAAGGG - Intronic
1194889602 X:99362321-99362343 TATCCTCTACTGCCTAATCAGGG - Intergenic
1197548068 X:127852259-127852281 AATGCAATACTGACTCAGAAAGG + Intergenic