ID: 1042188112

View in Genome Browser
Species Human (GRCh38)
Location 8:66157011-66157033
Sequence TCAGATCCACAATTAGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 115}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042188112_1042188115 -7 Left 1042188112 8:66157011-66157033 CCAGGACCTAATTGTGGATCTGA 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1042188115 8:66157027-66157049 GATCTGAATAATTGTCTGAAGGG No data
1042188112_1042188116 18 Left 1042188112 8:66157011-66157033 CCAGGACCTAATTGTGGATCTGA 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1042188116 8:66157052-66157074 CTGTTTACATTCTGAGAATTCGG No data
1042188112_1042188118 25 Left 1042188112 8:66157011-66157033 CCAGGACCTAATTGTGGATCTGA 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1042188118 8:66157059-66157081 CATTCTGAGAATTCGGGTTTAGG No data
1042188112_1042188114 -8 Left 1042188112 8:66157011-66157033 CCAGGACCTAATTGTGGATCTGA 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1042188114 8:66157026-66157048 GGATCTGAATAATTGTCTGAAGG No data
1042188112_1042188119 26 Left 1042188112 8:66157011-66157033 CCAGGACCTAATTGTGGATCTGA 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1042188119 8:66157060-66157082 ATTCTGAGAATTCGGGTTTAGGG No data
1042188112_1042188117 19 Left 1042188112 8:66157011-66157033 CCAGGACCTAATTGTGGATCTGA 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1042188117 8:66157053-66157075 TGTTTACATTCTGAGAATTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042188112 Original CRISPR TCAGATCCACAATTAGGTCC TGG (reversed) Intronic
900900315 1:5511388-5511410 TAAGACGCACAATTATGTCCTGG - Intergenic
901907729 1:12428780-12428802 TCACATCACCAATTAGGTGCTGG + Intronic
903560101 1:24220715-24220737 TCAGACCCACAGTCAGCTCCTGG + Intergenic
906463694 1:46057548-46057570 TCATATGGACAATAAGGTCCAGG + Intronic
911985559 1:104617469-104617491 TCATATGGACAATAAGGTCCAGG - Intergenic
912250570 1:108008238-108008260 TCAGATCCACAGATAGTGCCAGG + Intergenic
914801740 1:150967341-150967363 TCAGAGCCAAAATGAGGCCCTGG - Intronic
918464080 1:184804216-184804238 TGAGATCCACAATTAAATCCTGG - Intronic
920889478 1:209969772-209969794 TCAGAACCACAATGAGGGCCAGG - Intronic
921594460 1:217039113-217039135 TGATATCAACAATAAGGTCCAGG - Intronic
1070538310 10:77396043-77396065 ACAGAACCACTATTAAGTCCTGG + Intronic
1070587032 10:77774273-77774295 TCAGATCCCCACTGAGGTCATGG + Intergenic
1071447212 10:85759625-85759647 TCTAATCCATAATTAGGTCTTGG + Intronic
1072439925 10:95445408-95445430 TCAGAGCCAGAATCAGGCCCTGG - Intronic
1078482121 11:11686880-11686902 TGACATGAACAATTAGGTCCAGG + Intergenic
1080652755 11:34235653-34235675 GGAGATCCCCAATCAGGTCCTGG - Intronic
1085219625 11:74862548-74862570 TGACATCAACGATTAGGTCCTGG + Intronic
1086433691 11:86760420-86760442 TCAAATCCAAACTTAGGGCCGGG - Intergenic
1087342964 11:96932163-96932185 TCAGCTGCACAATTATGTGCAGG + Intergenic
1088427044 11:109715426-109715448 TGATATGCACAATAAGGTCCAGG - Intergenic
1089198751 11:116710798-116710820 GCAGCTCCACAGGTAGGTCCAGG - Intergenic
1090802574 11:130182083-130182105 GCAGATCCAGAATCTGGTCCTGG - Intronic
1093117333 12:15226937-15226959 TCAGATCCACCCTTAGTCCCAGG - Intronic
1096893755 12:54798847-54798869 TCACATCCAAAATTAAATCCTGG - Intergenic
1102231273 12:111264096-111264118 TCAGCTCCCCAAGTAGGTCCAGG - Intronic
1105061737 12:133158884-133158906 TCAGACTCAGAACTAGGTCCTGG + Exonic
1105306569 13:19173150-19173172 TCAGAACCCAAATCAGGTCCAGG - Intergenic
1106115977 13:26818021-26818043 TCAGAACCACAATCAGGGCAAGG + Intergenic
1106333876 13:28765101-28765123 TCAGATCCAGACTTAGGCCAGGG + Intergenic
1106548543 13:30751625-30751647 TCAGATCCACAAATCAGCCCAGG - Intronic
1107449663 13:40497198-40497220 TCAGATACAGACTTGGGTCCAGG + Intergenic
1107923953 13:45239947-45239969 TCAAATCCCTAATTAAGTCCTGG - Intronic
1114871718 14:26666508-26666530 TGATATCAACAATAAGGTCCAGG - Intergenic
1115128829 14:30028146-30028168 TCAAAACCACAATGAGGGCCGGG - Intronic
1120091225 14:80334975-80334997 TGATATGAACAATTAGGTCCAGG - Intronic
1121421501 14:93818864-93818886 TCACAGACACAATTAGATCCAGG - Intergenic
1125850894 15:42901918-42901940 TCAAAACCACAATGAGGGCCAGG + Intronic
1131239574 15:90727307-90727329 TCAAAACCACAATTAGGGCCAGG - Intronic
1131907674 15:97161739-97161761 TCCGATCCACACTGAGGTGCAGG - Intergenic
1132421343 15:101672641-101672663 TCAGATCCTGACTGAGGTCCTGG - Intronic
1135337108 16:21611766-21611788 TCAGCCCCACAATCAAGTCCCGG - Intronic
1138282960 16:55786040-55786062 TCACATCCCCCATTAAGTCCAGG - Intergenic
1138742909 16:59331510-59331532 TCAGATCCTCACTATGGTCCTGG + Intergenic
1140167642 16:72570457-72570479 TCACATCCATGATTAGGTTCAGG + Intergenic
1140842262 16:78850673-78850695 ACAGAGACACAAGTAGGTCCTGG - Intronic
1141239509 16:82252189-82252211 TCAGACCTGCAATTAGGCCCTGG + Intergenic
1141363236 16:83417211-83417233 TCAGATCCACACTTTTGACCTGG + Intronic
1143109567 17:4545606-4545628 TCACATCCAGAATTAGCTGCAGG + Exonic
1145787994 17:27606493-27606515 TCAGACCCACAATCGGGTGCAGG - Intronic
1146751506 17:35385615-35385637 TCAAAACCACAATGAGGGCCAGG - Intergenic
1153339431 18:3959369-3959391 TCAGAAACACAATTGGGGCCGGG + Intronic
1163494238 19:17635894-17635916 TCAGACCCACAATTACCCCCAGG + Intronic
928267677 2:29825332-29825354 TCAGATTCCCTGTTAGGTCCTGG + Intronic
930185794 2:48410985-48411007 CCAGAGCCACCATTAGTTCCTGG - Intergenic
931154770 2:59615553-59615575 TGAGATGGACAATAAGGTCCAGG - Intergenic
933047501 2:77557593-77557615 TGATATCAACAATAAGGTCCAGG + Intronic
934156113 2:89202792-89202814 TCAGATCCATAAGGAGGTACTGG - Intergenic
934211203 2:89979971-89979993 TCAGATCCATAAGGAGGTACTGG + Intergenic
935417425 2:102833641-102833663 TCTGTTCCAGAATTAGGTCCAGG + Intronic
936511509 2:113151188-113151210 TCAGAATCACAATAAGGTACTGG - Intergenic
936994346 2:118397842-118397864 CAATATGCACAATTAGGTCCAGG + Intergenic
938051066 2:128172183-128172205 TCAGGGTCACAGTTAGGTCCTGG - Intronic
938372247 2:130778471-130778493 TCAAAACCACAATGAGGGCCGGG + Intergenic
940547257 2:155103133-155103155 TGATATCAACAATAAGGTCCAGG - Intergenic
941671227 2:168295196-168295218 TTAGATCCAGAGTTAGGCCCTGG + Intergenic
942213708 2:173696992-173697014 TCACATCCATCATTAGCTCCTGG + Intergenic
943707244 2:191048478-191048500 TAAGATGCACCATTAGGGCCGGG + Intronic
945333362 2:208563768-208563790 TGATATGCACAATGAGGTCCAGG - Intronic
948679228 2:239621310-239621332 TCAGAGCCAGCATTATGTCCAGG + Intergenic
1168986316 20:2051961-2051983 CCAGTTCCAGAAATAGGTCCTGG + Intergenic
1173247158 20:41344773-41344795 TCAGACCCACAATCAGGCCTTGG - Intronic
1173395692 20:42677572-42677594 TCAGAAACACTATTAGATCCAGG + Intronic
1173452971 20:43181427-43181449 TCAGGTCCAGAGTCAGGTCCCGG - Intronic
1183453612 22:37909728-37909750 TGAGATCCAGAATCATGTCCAGG + Intronic
1184647885 22:45906036-45906058 TGAGATCCACAGTGAGGTCCCGG + Intergenic
950492816 3:13316531-13316553 TCAGATCCAGAATCAGGAGCTGG + Exonic
953803160 3:46044280-46044302 TCAAAACCACAATGAGGGCCAGG - Intergenic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
956306319 3:67830981-67831003 TCATATGAACAATAAGGTCCAGG + Intergenic
963025377 3:140913793-140913815 CCAGATCCACATTTCTGTCCTGG - Intergenic
963322047 3:143819464-143819486 ACAGAACTACAATTAGGACCAGG - Intronic
971808592 4:31394054-31394076 TCAGACCCACAACGATGTCCAGG + Intergenic
973991824 4:56416781-56416803 TCAGAGCCACAACCAGGTCAAGG + Intronic
981160194 4:141488261-141488283 GCAGATCCACAATTAGAACAAGG - Intergenic
981281779 4:142966888-142966910 TGATATGCACAATAAGGTCCAGG - Intergenic
984161219 4:176254834-176254856 TCAAAACCACAATGAGGGCCAGG + Intronic
984916257 4:184727466-184727488 TCACACCCACAATGAGGTGCTGG + Intronic
988271313 5:29021245-29021267 TAAGATACACAAATAGGTCCAGG - Intergenic
988929448 5:36022279-36022301 TCAGATCCAACACAAGGTCCTGG + Intergenic
991137402 5:63198147-63198169 GTAGATCTACAATTAGATCCAGG + Intergenic
1003245435 6:4378450-4378472 GCAGATCCCCGATTAGATCCTGG - Intergenic
1005681414 6:28212286-28212308 TAAGAGCCACAATTAGGACCAGG + Intergenic
1007189181 6:39998793-39998815 TCAGAACCACAGTTAGGTTTGGG - Intergenic
1008351399 6:50495314-50495336 GCAGATTCAAAATTAGGTCTAGG - Intergenic
1012076381 6:94691702-94691724 TGATATGCACAATTAAGTCCAGG - Intergenic
1015871557 6:137780931-137780953 TCAGATGCTCCACTAGGTCCAGG + Intergenic
1019967947 7:4515531-4515553 TCAGATCAACAATTATCTCTAGG + Intergenic
1020553553 7:9639843-9639865 TCTGATCCACAATACAGTCCAGG + Intergenic
1022251458 7:28612400-28612422 TCACATACTCAATTAGGTACAGG + Intronic
1023896787 7:44440437-44440459 TCTATTCCAGAATTAGGTCCAGG - Intronic
1024729091 7:52234816-52234838 TGATATCGACAATGAGGTCCAGG + Intergenic
1024745891 7:52405482-52405504 TCTGATCCACAATTCCCTCCAGG - Intergenic
1028076680 7:86525468-86525490 TCAAAACCACAATGAGGGCCGGG + Intergenic
1028253018 7:88558304-88558326 TGAGATGAACAATAAGGTCCAGG + Intergenic
1030849718 7:114468288-114468310 GCAGAGCCAGAATTTGGTCCTGG - Intronic
1032321146 7:130887754-130887776 TCCATTCCACAGTTAGGTCCTGG - Intergenic
1035495609 7:159323026-159323048 TCCGATCCCCAGTTTGGTCCAGG + Intergenic
1040072229 8:43197894-43197916 TCACATCCACAACTGGGTACAGG - Exonic
1040778896 8:51082493-51082515 TCAGATGCATTATTAGGTACAGG + Intergenic
1042188112 8:66157011-66157033 TCAGATCCACAATTAGGTCCTGG - Intronic
1047833407 8:128660893-128660915 TATGATCCTGAATTAGGTCCTGG + Intergenic
1048541551 8:135346539-135346561 TCAGCTCCACAATTTTGCCCAGG - Intergenic
1049390000 8:142362924-142362946 TGTGAGCCACACTTAGGTCCAGG + Intronic
1051294384 9:15579970-15579992 TCAGATTTAGATTTAGGTCCTGG + Intronic
1061561564 9:131407486-131407508 ACAGATCCAAAATAAGGGCCAGG - Intronic
1061838383 9:133343691-133343713 TCAGGTCCACACCTATGTCCAGG - Intronic
1062711931 9:137979725-137979747 TCTCATCCTCAGTTAGGTCCAGG + Intronic
1186804312 X:13124827-13124849 TCAGATCAACAATTAGATGATGG - Intergenic
1192219587 X:69188307-69188329 ACAGATCCAGATTTAAGTCCTGG + Intergenic
1195022824 X:100846891-100846913 TCAGAACCAGAATAAGGGCCGGG + Intronic
1195126828 X:101816166-101816188 TCATATGAACAATAAGGTCCAGG - Intergenic
1195863618 X:109407150-109407172 TGAGATGAACAATAAGGTCCAGG + Intronic
1196611617 X:117721046-117721068 TCAGATCCAACATATGGTCCTGG + Intergenic
1196932072 X:120691875-120691897 TCGAAACCACAATGAGGTCCAGG - Intergenic