ID: 1042191875

View in Genome Browser
Species Human (GRCh38)
Location 8:66195210-66195232
Sequence CAGCAATACCTCTATGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042191875_1042191878 19 Left 1042191875 8:66195210-66195232 CCTACCTCATAGAGGTATTGCTG No data
Right 1042191878 8:66195252-66195274 TGTACGTGATGTCCTTACTTTGG No data
1042191875_1042191879 26 Left 1042191875 8:66195210-66195232 CCTACCTCATAGAGGTATTGCTG No data
Right 1042191879 8:66195259-66195281 GATGTCCTTACTTTGGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042191875 Original CRISPR CAGCAATACCTCTATGAGGT AGG (reversed) Intergenic
No off target data available for this crispr