ID: 1042191875 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:66195210-66195232 |
| Sequence | CAGCAATACCTCTATGAGGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1042191875_1042191878 | 19 | Left | 1042191875 | 8:66195210-66195232 | CCTACCTCATAGAGGTATTGCTG | No data | ||
| Right | 1042191878 | 8:66195252-66195274 | TGTACGTGATGTCCTTACTTTGG | No data | ||||
| 1042191875_1042191879 | 26 | Left | 1042191875 | 8:66195210-66195232 | CCTACCTCATAGAGGTATTGCTG | No data | ||
| Right | 1042191879 | 8:66195259-66195281 | GATGTCCTTACTTTGGCTTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1042191875 | Original CRISPR | CAGCAATACCTCTATGAGGT AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||