ID: 1042192785

View in Genome Browser
Species Human (GRCh38)
Location 8:66204818-66204840
Sequence GTGAGACAGAACAGCTATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042192784_1042192785 21 Left 1042192784 8:66204774-66204796 CCTCTCTGATCACAGTACTCATC No data
Right 1042192785 8:66204818-66204840 GTGAGACAGAACAGCTATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042192785 Original CRISPR GTGAGACAGAACAGCTATCT TGG Intergenic
No off target data available for this crispr