ID: 1042203518

View in Genome Browser
Species Human (GRCh38)
Location 8:66304896-66304918
Sequence AAAGGCTAATGATGTATATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042203518_1042203523 1 Left 1042203518 8:66304896-66304918 CCACATATACATCATTAGCCTTT No data
Right 1042203523 8:66304920-66304942 CTACTGATGGCATGGTTACAAGG No data
1042203518_1042203524 11 Left 1042203518 8:66304896-66304918 CCACATATACATCATTAGCCTTT No data
Right 1042203524 8:66304930-66304952 CATGGTTACAAGGACTAGAATGG No data
1042203518_1042203520 -7 Left 1042203518 8:66304896-66304918 CCACATATACATCATTAGCCTTT No data
Right 1042203520 8:66304912-66304934 AGCCTTTCCTACTGATGGCATGG No data
1042203518_1042203526 27 Left 1042203518 8:66304896-66304918 CCACATATACATCATTAGCCTTT No data
Right 1042203526 8:66304946-66304968 AGAATGGAGATTTGAGCAGGAGG No data
1042203518_1042203525 24 Left 1042203518 8:66304896-66304918 CCACATATACATCATTAGCCTTT No data
Right 1042203525 8:66304943-66304965 ACTAGAATGGAGATTTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042203518 Original CRISPR AAAGGCTAATGATGTATATG TGG (reversed) Intergenic
No off target data available for this crispr