ID: 1042203521

View in Genome Browser
Species Human (GRCh38)
Location 8:66304914-66304936
Sequence AACCATGCCATCAGTAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042203521_1042203525 6 Left 1042203521 8:66304914-66304936 CCTTTCCTACTGATGGCATGGTT No data
Right 1042203525 8:66304943-66304965 ACTAGAATGGAGATTTGAGCAGG No data
1042203521_1042203526 9 Left 1042203521 8:66304914-66304936 CCTTTCCTACTGATGGCATGGTT No data
Right 1042203526 8:66304946-66304968 AGAATGGAGATTTGAGCAGGAGG No data
1042203521_1042203527 17 Left 1042203521 8:66304914-66304936 CCTTTCCTACTGATGGCATGGTT No data
Right 1042203527 8:66304954-66304976 GATTTGAGCAGGAGGACTCATGG No data
1042203521_1042203528 21 Left 1042203521 8:66304914-66304936 CCTTTCCTACTGATGGCATGGTT No data
Right 1042203528 8:66304958-66304980 TGAGCAGGAGGACTCATGGATGG No data
1042203521_1042203524 -7 Left 1042203521 8:66304914-66304936 CCTTTCCTACTGATGGCATGGTT No data
Right 1042203524 8:66304930-66304952 CATGGTTACAAGGACTAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042203521 Original CRISPR AACCATGCCATCAGTAGGAA AGG (reversed) Intergenic
No off target data available for this crispr