ID: 1042203524

View in Genome Browser
Species Human (GRCh38)
Location 8:66304930-66304952
Sequence CATGGTTACAAGGACTAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042203518_1042203524 11 Left 1042203518 8:66304896-66304918 CCACATATACATCATTAGCCTTT No data
Right 1042203524 8:66304930-66304952 CATGGTTACAAGGACTAGAATGG No data
1042203521_1042203524 -7 Left 1042203521 8:66304914-66304936 CCTTTCCTACTGATGGCATGGTT No data
Right 1042203524 8:66304930-66304952 CATGGTTACAAGGACTAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042203524 Original CRISPR CATGGTTACAAGGACTAGAA TGG Intergenic
No off target data available for this crispr