ID: 1042207198

View in Genome Browser
Species Human (GRCh38)
Location 8:66341362-66341384
Sequence CACAGATACTTGCATGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042207198_1042207201 30 Left 1042207198 8:66341362-66341384 CCCTTTTCATGCAAGTATCTGTG No data
Right 1042207201 8:66341415-66341437 GGAAAGAAACATCTCATTTCTGG No data
1042207198_1042207200 9 Left 1042207198 8:66341362-66341384 CCCTTTTCATGCAAGTATCTGTG No data
Right 1042207200 8:66341394-66341416 TTTCTGTCTGAAATTCTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042207198 Original CRISPR CACAGATACTTGCATGAAAA GGG (reversed) Intergenic
No off target data available for this crispr