ID: 1042211873

View in Genome Browser
Species Human (GRCh38)
Location 8:66389395-66389417
Sequence CCAACTTGGAAGTGGAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042211873_1042211880 5 Left 1042211873 8:66389395-66389417 CCTGGTCTCCACTTCCAAGTTGG No data
Right 1042211880 8:66389423-66389445 TGTTGCTGTATCCTCCACAGGGG No data
1042211873_1042211879 4 Left 1042211873 8:66389395-66389417 CCTGGTCTCCACTTCCAAGTTGG No data
Right 1042211879 8:66389422-66389444 TTGTTGCTGTATCCTCCACAGGG No data
1042211873_1042211885 28 Left 1042211873 8:66389395-66389417 CCTGGTCTCCACTTCCAAGTTGG No data
Right 1042211885 8:66389446-66389468 AGGAATGTTGTGTCCTCACAGGG No data
1042211873_1042211884 27 Left 1042211873 8:66389395-66389417 CCTGGTCTCCACTTCCAAGTTGG No data
Right 1042211884 8:66389445-66389467 GAGGAATGTTGTGTCCTCACAGG No data
1042211873_1042211881 8 Left 1042211873 8:66389395-66389417 CCTGGTCTCCACTTCCAAGTTGG No data
Right 1042211881 8:66389426-66389448 TGCTGTATCCTCCACAGGGGAGG No data
1042211873_1042211878 3 Left 1042211873 8:66389395-66389417 CCTGGTCTCCACTTCCAAGTTGG No data
Right 1042211878 8:66389421-66389443 CTTGTTGCTGTATCCTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042211873 Original CRISPR CCAACTTGGAAGTGGAGACC AGG (reversed) Intergenic
No off target data available for this crispr