ID: 1042214722

View in Genome Browser
Species Human (GRCh38)
Location 8:66418728-66418750
Sequence CTGTTGAATGGTAAGTTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042214722_1042214727 0 Left 1042214722 8:66418728-66418750 CCAGCCAACTTACCATTCAACAG No data
Right 1042214727 8:66418751-66418773 TGAGGGTGAAATAAAGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042214722 Original CRISPR CTGTTGAATGGTAAGTTGGC TGG (reversed) Intergenic
No off target data available for this crispr