ID: 1042215276

View in Genome Browser
Species Human (GRCh38)
Location 8:66424960-66424982
Sequence GCAGGAGGAAGATGGCTGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042215268_1042215276 13 Left 1042215268 8:66424924-66424946 CCTAGGCCTGCAGCAACCAAGGG No data
Right 1042215276 8:66424960-66424982 GCAGGAGGAAGATGGCTGCGTGG No data
1042215270_1042215276 7 Left 1042215270 8:66424930-66424952 CCTGCAGCAACCAAGGGAGCAGC No data
Right 1042215276 8:66424960-66424982 GCAGGAGGAAGATGGCTGCGTGG No data
1042215272_1042215276 -3 Left 1042215272 8:66424940-66424962 CCAAGGGAGCAGCTAGAGGAGCA No data
Right 1042215276 8:66424960-66424982 GCAGGAGGAAGATGGCTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042215276 Original CRISPR GCAGGAGGAAGATGGCTGCG TGG Intergenic