ID: 1042216057

View in Genome Browser
Species Human (GRCh38)
Location 8:66430170-66430192
Sequence TTTCTCTTGCCACCCAAGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 281}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042216057_1042216062 5 Left 1042216057 8:66430170-66430192 CCTGGCTTGGGTGGCAAGAGAAA 0: 1
1: 0
2: 2
3: 21
4: 281
Right 1042216062 8:66430198-66430220 GACAGCGCCCAGGAGGAAAGAGG 0: 1
1: 0
2: 2
3: 32
4: 289
1042216057_1042216063 8 Left 1042216057 8:66430170-66430192 CCTGGCTTGGGTGGCAAGAGAAA 0: 1
1: 0
2: 2
3: 21
4: 281
Right 1042216063 8:66430201-66430223 AGCGCCCAGGAGGAAAGAGGAGG 0: 1
1: 0
2: 3
3: 30
4: 383
1042216057_1042216060 -5 Left 1042216057 8:66430170-66430192 CCTGGCTTGGGTGGCAAGAGAAA 0: 1
1: 0
2: 2
3: 21
4: 281
Right 1042216060 8:66430188-66430210 AGAAAAGGAGGACAGCGCCCAGG 0: 1
1: 0
2: 1
3: 25
4: 267
1042216057_1042216061 -2 Left 1042216057 8:66430170-66430192 CCTGGCTTGGGTGGCAAGAGAAA 0: 1
1: 0
2: 2
3: 21
4: 281
Right 1042216061 8:66430191-66430213 AAAGGAGGACAGCGCCCAGGAGG 0: 1
1: 0
2: 1
3: 15
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042216057 Original CRISPR TTTCTCTTGCCACCCAAGCC AGG (reversed) Exonic
900341250 1:2190381-2190403 TTTCTCCTGCCACCCCTGCCTGG - Intronic
902678751 1:18028448-18028470 TTTGCCTTCCCACCCCAGCCTGG + Intergenic
903412651 1:23158614-23158636 TTGCTCTTGCCACTCAGGTCAGG - Intronic
903438623 1:23370618-23370640 TTTCCCTTACCACCAAAGCCAGG - Exonic
903958692 1:27042553-27042575 TCTCTCTTGTCACCCAGGCTCGG - Intergenic
905706584 1:40064465-40064487 TCTCTCTAGGCTCCCAAGCCTGG + Exonic
907833157 1:58084614-58084636 GGTCTCTGGCAACCCAAGCCTGG - Intronic
908017466 1:59858705-59858727 TTTCTCTTTCACACCAAGCCTGG - Intronic
908802071 1:67890724-67890746 GTTCTCTTTCCACCAAAGCATGG + Intergenic
910686462 1:89922092-89922114 TTGCTCTTGTTACCCAGGCCAGG + Intronic
911146373 1:94556085-94556107 TTTTGCTTGCCTTCCAAGCCTGG + Intergenic
912724838 1:112049934-112049956 TTTCTTTTGCCACCCCAGTAGGG + Intergenic
912737827 1:112165684-112165706 TTTCTCTTTCCTCCCAACTCAGG - Intergenic
915242458 1:154533045-154533067 TTTCTATTGACACCCAGGCAGGG + Intronic
915538777 1:156554245-156554267 TTTCTCCTTCCACCTCAGCCAGG + Exonic
916175584 1:162035485-162035507 TTTCTCCTGCCACCTGGGCCAGG - Intergenic
917982777 1:180282248-180282270 TTTCTCTTGCTTGCCAACCCTGG + Intronic
919768418 1:201141874-201141896 TGTCTCCTGCCATCCTAGCCAGG - Intronic
919962993 1:202491153-202491175 TTGCTCTTGTCACGCAGGCCGGG + Intronic
919971283 1:202581000-202581022 TTTCTCTTGGCACCCCAATCAGG - Exonic
921481166 1:215666200-215666222 TTACTCTTACCACCAAAGACCGG + Intronic
924088747 1:240481076-240481098 TTGCTCTTGTCACCCAGGCTGGG - Intergenic
1063532286 10:6845295-6845317 TTGCTCTTGTCACCCAGGCTGGG - Intergenic
1065927793 10:30451060-30451082 TTGCTCTTGTCACCCAGGCTGGG - Intronic
1068861473 10:61852190-61852212 TTTCACATGCCACCTAAACCTGG + Intergenic
1069760679 10:70809056-70809078 TTTCTCTGGCCACACTGGCCTGG + Intergenic
1070323862 10:75374943-75374965 TCTCTCCTGCCACCCCAACCAGG + Intergenic
1070577386 10:77689476-77689498 ATTCTCTTGCCATCCCAGCAAGG - Intergenic
1070591901 10:77807489-77807511 TTTCTGGTGTCCCCCAAGCCAGG - Intronic
1070591933 10:77807688-77807710 TGTTTCTTGCCCCCCAAGGCTGG - Intronic
1070706325 10:78641756-78641778 TTTCTCCTGCTTCACAAGCCCGG + Intergenic
1073600639 10:104842891-104842913 TTTCTCATGTGAGCCAAGCCAGG - Intronic
1074713998 10:116201670-116201692 TTTCACTGGAGACCCAAGCCTGG - Intronic
1076431166 10:130403394-130403416 GTTCTCTTGCCAGCGCAGCCAGG + Intergenic
1077395590 11:2319307-2319329 TTGCTCTTGTCACCCAGGCTGGG - Intergenic
1077991680 11:7417637-7417659 TTTCTCTTGCTATCCTGGCCAGG + Intronic
1078838740 11:15057652-15057674 TTTCTCTGGCCACAGAAGCTTGG + Intronic
1079022657 11:16922705-16922727 CTTCTCCTGCCACCCATCCCAGG + Intronic
1082988672 11:59188784-59188806 TTTCTCTTACCTGCCAAGGCAGG - Exonic
1083288338 11:61675397-61675419 TTTCTCTGGCCTCCCCAGACAGG + Intergenic
1083870854 11:65487691-65487713 TTCCTCTTGCCACCGAAATCTGG - Intergenic
1085912287 11:80842113-80842135 TTGCTCTTGTCACCCAGGCTGGG + Intergenic
1088065044 11:105707145-105707167 TTTCTATTGTCATCAAAGCCAGG - Intronic
1089167101 11:116485693-116485715 CTTTTCTTCCCACCCAATCCAGG - Intergenic
1090455961 11:126850068-126850090 TTTCTTTAGCCACCAAAGCGGGG + Intronic
1090831425 11:130423412-130423434 TTTCTGTTGTCATCCAAACCAGG + Intronic
1090997583 11:131880810-131880832 TTTCTTTTGCCCCCAAAGCTGGG + Intronic
1091795391 12:3294951-3294973 GTTGTCTTGCCACCCCAGCCGGG - Intergenic
1093945324 12:25101165-25101187 TTTCTCTTGCTAGGAAAGCCGGG + Exonic
1096477866 12:51919424-51919446 TTGCTCTTGTCACCCAGGCTGGG + Intronic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1097175465 12:57140004-57140026 TGTCTATTGGCCCCCAAGCCTGG - Intronic
1097837022 12:64283311-64283333 TTGCTCTTGTCACCCAGGCTGGG - Intronic
1098300050 12:69045038-69045060 CGTCTCTTACCACTCAAGCCTGG - Intergenic
1099066227 12:77983268-77983290 ATTCTCTTGCCACCAGAGCAGGG - Intronic
1099226928 12:79980952-79980974 TCACTCTTGTCACCCAAGGCTGG + Intergenic
1102107141 12:110335221-110335243 TTTCTGTGGCCTCACAAGCCCGG + Intronic
1103246713 12:119464278-119464300 TTGCTCTTGCAACCCAACTCTGG - Intronic
1103246797 12:119464808-119464830 TTGCTCTTGCAACCCAACTCTGG + Intronic
1103515151 12:121503006-121503028 TTGCTCTTGTCACCCAGGCTAGG + Intronic
1103731780 12:123032663-123032685 TCTCAATTCCCACCCAAGCCAGG - Intronic
1104620477 12:130308150-130308172 TTCCTCCTGCCCCCCAGGCCTGG + Intergenic
1107599959 13:42003296-42003318 ATTTTCTTGCCTCCCAAGTCAGG - Intergenic
1107963725 13:45580753-45580775 TCTTTCTTGGCACCCAAGGCTGG + Intronic
1111908521 13:94283784-94283806 TTTCTCTTGCCAATTAAACCAGG - Intronic
1112678894 13:101739479-101739501 TTTTCCTTACCACCCAAGCTAGG - Intronic
1115152629 14:30302902-30302924 TTGCTCTTCCCATCCAACCCTGG + Intergenic
1115542528 14:34435657-34435679 TTGCTCTTGTTACCCAAGGCTGG + Intronic
1116406724 14:44575401-44575423 TTGCTCTTGTCACCCAGGCTGGG - Intergenic
1117259244 14:54013646-54013668 TTGCTCTTGTCACCCAGGCTGGG + Intergenic
1118014898 14:61650094-61650116 TTGCTCTTGTCACCCAGGCTGGG - Intronic
1118744175 14:68762098-68762120 TTGCTCTTGTCACCCAAGCTGGG + Intergenic
1119989809 14:79183694-79183716 TGTCTCTTACCGCCAAAGCCCGG + Intronic
1120112773 14:80577574-80577596 TCTCTGCTGCCACCCAATCCAGG + Intronic
1121079289 14:91094790-91094812 TTGCTCTTGTCACCCAGGCTAGG - Intronic
1121329460 14:93040811-93040833 GTTCTCCTGCCTCCCAAGCTTGG - Intronic
1121904106 14:97723959-97723981 TTTATTTTGCATCCCAAGCCAGG + Intergenic
1122170169 14:99866537-99866559 TTGCTCTTGTCACCCAGGCTGGG - Intronic
1122274982 14:100586805-100586827 TTTCTCCGGCCTCCCAAGCAGGG + Intronic
1122542999 14:102508262-102508284 CTTCTGTTCCCACCTAAGCCAGG + Intronic
1124995975 15:34723225-34723247 TTTCTCTTGTCTCCCAGGCTGGG + Intergenic
1125121745 15:36168158-36168180 TTTCTCTTGCCAAGATAGCCTGG - Intergenic
1127444329 15:59045218-59045240 TTGTTCTTGTCACCCAGGCCTGG + Intronic
1128067551 15:64774563-64774585 TTTGTCCTGGCAACCAAGCCAGG - Intronic
1130042092 15:80413636-80413658 TTCCTTTTGCCACCTAAGCCTGG - Intronic
1130327015 15:82889379-82889401 GTTCACTGGCTACCCAAGCCTGG - Intronic
1130830743 15:87596311-87596333 TTGCTCTTGTCACCCAGGCTGGG + Intergenic
1131779937 15:95845244-95845266 TTTCTCCTGTCACCAAAGACAGG - Intergenic
1131825014 15:96313624-96313646 TTTCTCTTGGCCCCCAAACCAGG - Intergenic
1132376778 15:101333392-101333414 TGTCTCCTGCGACCCAAGCTGGG + Intronic
1132936393 16:2483420-2483442 TCTCTCTTGCCAGCTCAGCCTGG - Intronic
1133389935 16:5402111-5402133 TTCCTCTTGCCTCTGAAGCCTGG - Intergenic
1134689153 16:16179618-16179640 TTGCTCTTGTCACCCAGGCTGGG + Intronic
1134776141 16:16855334-16855356 TCTCTCTGGCCAGCCAAGCCTGG + Intergenic
1135187807 16:20330174-20330196 TTGCTCTTGTCACCCAGGCTGGG + Intergenic
1135196605 16:20400090-20400112 TTGCTCTTGTCACCCAGGCTGGG + Intronic
1135270045 16:21061263-21061285 TCACTCTTGTCACCCAAGGCTGG + Intronic
1135504549 16:23025071-23025093 TTGCTCTTGCCACCCCGGGCTGG - Intergenic
1137504068 16:49035783-49035805 TGTCCCTTCCCTCCCAAGCCTGG + Intergenic
1138665572 16:58564903-58564925 TTTCTCTTGTTACCCAGGCTGGG - Intronic
1139503803 16:67388917-67388939 TGCCTCTTGCCTCCCAGGCCAGG - Intergenic
1141433628 16:83984697-83984719 TTTCTCTTGTCACCCAGGTTGGG - Intronic
1141703194 16:85651690-85651712 TGACTCTGGCCACCCAAGGCTGG + Intronic
1141923211 16:87150315-87150337 TTCTTGTTGCCACCCAAGCATGG - Intronic
1143335235 17:6167162-6167184 ATTCTCTTGCCATCCATACCTGG - Intergenic
1144825384 17:18102850-18102872 GTTCACTTGCCACCACAGCCTGG + Intronic
1144916696 17:18729423-18729445 TTGCTCTTTCCCCCCAAGGCCGG + Intronic
1147865153 17:43546795-43546817 TTCCTCTGGGCACACAAGCCCGG - Intronic
1148587836 17:48793563-48793585 TTGCTCTTGTCACCCCAGACTGG - Intronic
1148677644 17:49454366-49454388 TTTCTCTTGCCATCCAAATTGGG - Intronic
1149617539 17:58013739-58013761 TTGCTCTTGTCACCCAGGCTGGG - Intergenic
1149982959 17:61325797-61325819 TTTATCTTGCCACCAAGACCAGG - Intronic
1150971873 17:70037995-70038017 TTGCTCTTGTCACCCAGGCTAGG + Intergenic
1151497037 17:74464338-74464360 TTGCTCTTGTCACCCAGGCTGGG + Intergenic
1151899683 17:77003633-77003655 TCTCTCTTGCCACCCACGTATGG + Intergenic
1152151492 17:78604030-78604052 TCGCTCTTGTCACCCAAGGCTGG - Intergenic
1152698680 17:81808460-81808482 TCACTCTTGCCACCCAGGGCTGG - Intronic
1155540587 18:26864367-26864389 TTTATCCTGCCACCCGGGCCTGG - Intronic
1156040291 18:32813043-32813065 TTTCTCAGGCCATACAAGCCTGG - Intergenic
1157089647 18:44622601-44622623 TTTCTCATGCCACACACACCTGG + Intergenic
1157231173 18:45917229-45917251 TTACTCTTGCCTCCCTAGACAGG + Intronic
1157866928 18:51196268-51196290 TTTCTGGTGCCACGCCAGCCTGG + Intronic
1159847080 18:73474563-73474585 TTGCTCTTGTCACCCAGGCTAGG + Intergenic
1161270803 19:3388211-3388233 TTTCTCCTGCCACCCTCTCCAGG - Intronic
1161622804 19:5308185-5308207 CTTCTCCTGCCAGCCACGCCCGG + Intronic
1162425679 19:10594041-10594063 TTTTTCATGCCAAACAAGCCTGG - Intergenic
1162941781 19:14014729-14014751 TTGCTCTTGTCACCCAGGCTGGG - Intergenic
1163491427 19:17619186-17619208 TTTCTCCTGTTACACAAGCCTGG - Intronic
1166596442 19:44054201-44054223 TTGCTCTTGTCACCCAGGCTGGG + Intronic
1167171384 19:47834557-47834579 TTTCTCTTGGCACCCCAGGCTGG + Intronic
1168398029 19:56065517-56065539 TTGCTCTTGTCACCCAGGCTGGG + Intergenic
924984048 2:252442-252464 TTTCTCCTGCCTCCCATCCCAGG - Intronic
925879220 2:8337430-8337452 TTCCTATCGCCACTCAAGCCTGG + Intergenic
927546767 2:23961124-23961146 TTGCTCTTGTCACCCAGGCTGGG + Intronic
928023481 2:27721679-27721701 TTCCTCTTTCCACCCATGCTGGG + Intergenic
929163409 2:38856395-38856417 TTTCTCTTTCTTCCCAAGCAGGG + Exonic
930017520 2:46981289-46981311 TTGCTCTTTCCACCCAGGCTTGG + Intronic
931376658 2:61713915-61713937 ATCCTCCTGCCACCCAGGCCAGG - Intergenic
933515991 2:83302497-83302519 TTACTCATGCCACCCATGCTAGG - Intergenic
933805680 2:85996851-85996873 TTCCTCTTGCCGGCCAGGCCTGG + Intergenic
937480936 2:122258718-122258740 TTTCACTTGTCACCCAGGCTGGG + Intergenic
938130547 2:128712123-128712145 TTACTCTTGTCACCCAAGCTGGG + Intergenic
938337663 2:130513643-130513665 CTTCTCATGCCACCCAGGCTGGG + Intergenic
938352176 2:130607092-130607114 CTTCTCATGCCACCCAGGCTGGG - Intergenic
938897321 2:135765238-135765260 TTGCTCTTGTCGCCCAAGCTGGG + Intronic
939599268 2:144167912-144167934 TTTCTCTTACCCTCCAACCCTGG + Intronic
939986491 2:148834236-148834258 TTGCTCTTGTCACCCAGGCTAGG + Intergenic
942748255 2:179260671-179260693 TTCATCTTGACACCGAAGCCAGG + Intronic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
945954176 2:216069903-216069925 TTGCTCTTGTCACCCAGGCTGGG - Intronic
946290741 2:218743111-218743133 TTGCTCTTGTCACCCAGGCTGGG - Intronic
946392635 2:219425837-219425859 TCTCTCTTGCCCCACTAGCCAGG - Intronic
946593038 2:221272532-221272554 TTGCCCTTTCCACCAAAGCCTGG - Intergenic
948180688 2:235977657-235977679 TTTGTCTTTCCTCCCAGGCCTGG + Intronic
948877162 2:240835762-240835784 TGTCATTTGCCGCCCAAGCCGGG - Intergenic
1169169040 20:3449243-3449265 TTGCTCTTGTCACCCACGCCTGG - Intergenic
1169447469 20:5684459-5684481 TTTTTATTGCCAGCAAAGCCAGG - Intergenic
1170544946 20:17427870-17427892 TTTCTCTTGCCACCCTGTCTAGG - Intronic
1170590432 20:17767308-17767330 CCTCTCTTTCCCCCCAAGCCTGG + Intergenic
1173176983 20:40771910-40771932 TTATTCTTGTCACCCAAGCCCGG + Intergenic
1173959931 20:47062975-47062997 TTTCTTTTGCTGCCAAAGCCTGG + Intronic
1174029240 20:47608283-47608305 TTGCTCTTGTCACCCAGGCTGGG - Intronic
1174513386 20:51072926-51072948 TGCCTCTTCCCACCCAGGCCAGG - Intergenic
1175095832 20:56540938-56540960 TTTGTCTTGTCACCCAGGCTAGG + Intergenic
1175142858 20:56873622-56873644 TTTTTCTTCCCACCCGAGCACGG + Intergenic
1175944505 20:62552436-62552458 TCTCTCTTACCACCCAGGGCAGG - Intronic
1176821683 21:13664330-13664352 TTTCTCCTCCCACCCAATGCAGG + Intergenic
1177062712 21:16394776-16394798 GTTCTCCTGCCAGCCAAGGCTGG - Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1179448758 21:41453143-41453165 TCTCTCTTGCCACCGCCGCCAGG - Intronic
1181300017 22:21873201-21873223 TTGCTCTTGTCACCCAGGCTGGG - Intergenic
1181845481 22:25704983-25705005 TTTCTTATGCCAAGCAAGCCTGG - Intronic
1182643032 22:31783636-31783658 TCACTCTTGCCACCCAAGGCTGG - Intronic
950373078 3:12547510-12547532 TTTCTCTTGTCACCCAAGCTGGG - Intronic
951617147 3:24560111-24560133 ATTTTCTTGCCACCCATGCCTGG + Intergenic
951669794 3:25167863-25167885 TTTTTCTTTCCACCCTACCCTGG + Intergenic
951960017 3:28307492-28307514 TTTTTCTTGTCACCCAGGCTGGG - Intronic
952026609 3:29090063-29090085 TTGCTCTTGTCACCCCAGGCTGG - Intergenic
952197680 3:31093210-31093232 TTTCTCTTCCCACTCCAGCATGG + Intergenic
952339907 3:32436804-32436826 TGTCTCCTGCCACCCATGCTTGG - Intronic
953626328 3:44574897-44574919 TTGCTCTTGTCACCCAGGCTGGG - Intronic
953875154 3:46662445-46662467 TTTCTCTTGACTCACAGGCCCGG - Intergenic
954215913 3:49124418-49124440 TTGTGCCTGCCACCCAAGCCGGG - Exonic
954414258 3:50385235-50385257 TTTCCCTTGCCTCCCCAGTCTGG - Intronic
954466526 3:50658395-50658417 TTTCTTTTTCCACCCCAGGCTGG - Intergenic
954676923 3:52321145-52321167 TTGCTCTTGTCACCCAGGCTGGG + Intronic
954752277 3:52820410-52820432 TTAATCTTGCTACCCAATCCTGG + Intronic
955647338 3:61154172-61154194 TTCCTCTAGCCATGCAAGCCTGG + Intronic
956581586 3:70819927-70819949 TTTCTCTTCCCATCTAAGCCAGG - Intergenic
957519053 3:81295375-81295397 TGTCTCATTTCACCCAAGCCTGG - Intergenic
958534395 3:95379588-95379610 TGTCTCTAGCCACACAAGTCAGG + Intergenic
959521280 3:107325764-107325786 TTTCCCTTCCCACCAAACCCTGG + Intergenic
961472561 3:127125254-127125276 TTTCTCTTTCCCTCCAACCCTGG + Intergenic
962616922 3:137135563-137135585 TTGCTCTGGTCACCCAAGGCTGG - Intergenic
963040299 3:141065333-141065355 TGTGTCTTGCCGCTCAAGCCTGG + Intronic
963561434 3:146870747-146870769 TTGCTCTTGTCGCCCATGCCTGG - Intergenic
965566942 3:170129728-170129750 TTGCTCTTGTCACCCAGGCTGGG + Intronic
966933757 3:184692134-184692156 TTTCTCTTTCACCCCAAGTCTGG - Intergenic
967414654 3:189202728-189202750 TTTCTCTTTCCCCCAGAGCCAGG - Intronic
967891600 3:194367950-194367972 TTTCTCCTGCCACCCTTGCCAGG - Intronic
968045427 3:195621380-195621402 TTTCAGTTTCCACCCAAGTCTGG - Intergenic
968064221 3:195749401-195749423 TTTCAGTTTCCACCCAAGTCTGG - Intronic
968703004 4:2065507-2065529 CTTCTCCTGCCACCAAAGCCAGG - Exonic
969696250 4:8736749-8736771 TTGCTCTTGTCACCCAGGCTGGG + Intergenic
971886205 4:32451562-32451584 TTTGTCTTGTCACCAAAGACTGG - Intergenic
972601391 4:40576009-40576031 GTTCTGTCGCCACCCAAGGCAGG + Intronic
973950638 4:56009876-56009898 TTTCTCTTGCCATTGTAGCCAGG - Exonic
974018804 4:56675041-56675063 CTTCTATTGCTACCCAAGCATGG + Intronic
975589729 4:75988023-75988045 TTTCTCTACCTACCCAATCCAGG + Intronic
975600610 4:76095951-76095973 TTGCTCTTGTCACCCAGGCTGGG + Intronic
981197294 4:141936255-141936277 TTGCTCTTGTCACCCAGGCTAGG - Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
981537405 4:145814324-145814346 TTTCTCTGGCCACTGAAACCTGG + Intronic
982910019 4:161128243-161128265 TGTCACTTGCTACCCAAGACTGG - Intergenic
983022355 4:162693521-162693543 TTTCTGAGGCCTCCCAAGCCAGG - Intergenic
983912801 4:173258901-173258923 TTTTTCTTGCCTCCTAAGACAGG + Intronic
986382907 5:7204733-7204755 TTTATCTGGCCACCCATCCCAGG + Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
996540216 5:124623893-124623915 TTGCTCTTGTCACCCCAGGCTGG + Intergenic
999381826 5:151126745-151126767 TTGCTCTTGTCACCCAGGCTGGG + Intronic
1000485339 5:161835174-161835196 TCTTTCTGCCCACCCAAGCCTGG + Intergenic
1001005721 5:168048014-168048036 TTTCTCTTTCATGCCAAGCCAGG - Intronic
1001118549 5:168959728-168959750 TTTGTCTTCCCTCCCAAGCTGGG + Intronic
1004704451 6:18110943-18110965 TTGCTCTTGTCACCCAGGCTGGG - Intergenic
1006934056 6:37705336-37705358 TTTCTCCTCACACCCCAGCCGGG - Intergenic
1007095138 6:39208337-39208359 TTCCCCTTCCCACCCAAACCGGG + Intronic
1007362166 6:41366775-41366797 TTGCTCTTGTCACCCAGGCTGGG - Intergenic
1008003608 6:46386575-46386597 TTGCTCTTGTCACCCAGGCTGGG - Intronic
1008086352 6:47248840-47248862 TCTCTCTTGCCTCCAGAGCCTGG + Intronic
1010563696 6:77383158-77383180 GTTATCTTGCAACCCAGGCCTGG + Intergenic
1011184941 6:84663674-84663696 CTTCTCTTTCCACCCATGACAGG - Intergenic
1013001900 6:106031367-106031389 ATTCTTTTGCCCCCTAAGCCTGG - Intergenic
1013318865 6:108967324-108967346 TTTCCTTTGTTACCCAAGCCTGG + Intronic
1013664967 6:112338482-112338504 ATTCTGTTGGCACCCAAGGCTGG + Intergenic
1013903247 6:115182618-115182640 TTGCTCTTGTCACCCAGGCTGGG - Intergenic
1014551934 6:122799186-122799208 TTCCTGTTGCCACCCAAGGAAGG + Intronic
1014798023 6:125748250-125748272 GTTCTCTGTCCACACAAGCCCGG - Intronic
1017072544 6:150588479-150588501 TTGCTCTTGCCACCCAGGCTGGG - Intergenic
1019102125 6:169640044-169640066 TTCTTCTTGCCATCCCAGCCCGG - Intronic
1019267981 7:129466-129488 TGTCCCTTGCAACCCAGGCCAGG - Intergenic
1019677608 7:2324088-2324110 TTGCCCTTGCCACCCCAGGCTGG - Intronic
1020665502 7:11036483-11036505 TTTCCCTTGGAACCCAGGCCTGG - Exonic
1022006539 7:26271092-26271114 TCACTCTTGTCACCCAGGCCGGG + Intergenic
1022320789 7:29286045-29286067 TTTCTCTGCCTTCCCAAGCCAGG + Intronic
1023989945 7:45122739-45122761 TTCCTCTCGACCCCCAAGCCAGG + Intergenic
1024219005 7:47273336-47273358 TTTCTCCAGCCCCCCAACCCTGG + Intergenic
1029863201 7:103597569-103597591 TCACTCTTGTCACCCAAGCTGGG - Intronic
1030687533 7:112502639-112502661 TTTCTCTTACCACCCAGGCCTGG - Intergenic
1031515306 7:122692025-122692047 TGTCTGGTGCCACCCAAGCCAGG + Intronic
1032110328 7:129070307-129070329 TTGCTCTTGTCACCCCAGGCTGG + Intergenic
1033244668 7:139707881-139707903 TTTCTATTCCCACCCAGTCCAGG + Intronic
1033308105 7:140239503-140239525 ATGCACTTGCCACCAAAGCCCGG - Intergenic
1034157159 7:148965364-148965386 TTGCTCTTGTCACCCAGGCTGGG + Intergenic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1036683981 8:10896369-10896391 TGAGTCTTGCCACCCAAACCAGG + Intronic
1036787572 8:11698055-11698077 TCTCTCCTCCCACCCAGGCCCGG + Intronic
1036952674 8:13156485-13156507 TTTTCCTTCCCACCAAAGCCTGG + Intronic
1037449908 8:19006261-19006283 TCGCTCTTGTCACCCAGGCCGGG - Intronic
1037779038 8:21855257-21855279 TTCCCCTTGCCTCCTAAGCCAGG + Intergenic
1038056642 8:23864751-23864773 CTTCTCTAGTCACCCAACCCAGG - Intergenic
1038769021 8:30458992-30459014 TCACTCTTGTCACCCAAGCTGGG + Intronic
1039573977 8:38608878-38608900 TTTCTCTTCCTACCCACTCCAGG + Intergenic
1040851057 8:51900078-51900100 TCGCTCTTGCCGCCCAGGCCAGG - Intergenic
1041125771 8:54636705-54636727 TTGCTCTTGCCGCCCAGGCTGGG - Intergenic
1042216057 8:66430170-66430192 TTTCTCTTGCCACCCAAGCCAGG - Exonic
1042497553 8:69471937-69471959 TTTCTTCTGCCACCAAAGGCAGG + Intronic
1042738912 8:72020943-72020965 TTTCTCTTACCACCAAATTCAGG + Intronic
1043829932 8:84975719-84975741 TTTGTGTTGCCACCAAATCCTGG - Intergenic
1044237188 8:89844288-89844310 TTGCTCTTGTCACCCAGGCTGGG - Intergenic
1044762293 8:95533530-95533552 TTGCTTTTGTCACCCAAGCCGGG - Intergenic
1045467928 8:102486701-102486723 TCACTCTTGCCACCCAGGCTCGG + Intergenic
1047704947 8:127488761-127488783 TTTCTGATGCCACCCAGGCAAGG + Intergenic
1048961718 8:139585203-139585225 TTGCTACTGCCACCCAGGCCAGG + Intergenic
1049476467 8:142799311-142799333 TTCCTCTGCCCACCCATGCCTGG + Intergenic
1050558619 9:6810838-6810860 TTGCTCTTGTCACCCAGGCTCGG - Intronic
1050910663 9:11065369-11065391 TTGCTCTTGTCACCCAGGCTGGG + Intergenic
1050952875 9:11618918-11618940 ACTCTCTTGCCACCCTACCCTGG + Intergenic
1052459959 9:28750366-28750388 TTTCTCTTTCCACCAAAGTTTGG - Intergenic
1053037289 9:34836043-34836065 TTTCTCTTTCCAGCCAGGGCTGG - Intergenic
1053043353 9:34893143-34893165 TTTCTCTTCCCAGCCAGGGCTGG - Intergenic
1053864575 9:42423418-42423440 TTGCTCTTGCTGCCCAAGGCTGG - Intergenic
1055664853 9:78543017-78543039 GTCCTCCTGCCAGCCAAGCCGGG + Intergenic
1055696350 9:78889294-78889316 TTACTCTTGTCACCCAGGCTGGG + Intergenic
1056211729 9:84371199-84371221 TTACTCTTGTCACCCAGGCTGGG + Intergenic
1057792235 9:98131979-98132001 TGTATCTTGCCACCCAAGGAGGG - Intronic
1057874285 9:98742191-98742213 TTTCTTTTGCAACGCAAGCTTGG - Intronic
1057951642 9:99373777-99373799 ATTCTCCTGCCTCCCAACCCAGG + Intergenic
1058574408 9:106384723-106384745 ATTCTCTTCCCAGCAAAGCCAGG + Intergenic
1059239380 9:112790102-112790124 TTTCCCTTGCCACACAGCCCAGG - Intronic
1059378790 9:113907469-113907491 GTTCTCTTGCCACCCCGGGCAGG + Intronic
1059737916 9:117120743-117120765 TTTCCATTGCCACCCAAGAGAGG + Intronic
1062145623 9:134988204-134988226 ATTCTCTTCCCACCAAAGCCCGG + Intergenic
1062185020 9:135213503-135213525 CTTCTCTTCCCACCCTAACCTGG - Intergenic
1186629631 X:11335144-11335166 TTGCTCTTCTCACCCAAGGCTGG + Intronic
1186755050 X:12661986-12662008 TTTCTCTTCCCACCTAAACCTGG - Intronic
1189407874 X:40741894-40741916 TTGCTCTTGTCACCCAGGCTGGG - Intergenic
1189671216 X:43411326-43411348 TTTGTCTTACCACACAAGTCAGG + Intergenic
1189739684 X:44105140-44105162 TTTCTCTGGCAACCAATGCCTGG - Intergenic
1191997960 X:67116683-67116705 TTTCTACTGCAAGCCAAGCCGGG - Intergenic
1192276872 X:69640996-69641018 TTTATCTTGACTCCAAAGCCTGG + Intronic
1196784415 X:119409644-119409666 TCTCTCTTGTCACCCATGCTGGG + Intronic
1197749598 X:129955416-129955438 TTTCTATTGCCACCCATCCTTGG - Intergenic
1198186229 X:134256544-134256566 CTTCTCTTTCCACCCAAGGTGGG + Intergenic
1198461113 X:136863719-136863741 TTGCTCTTGTCACCCCAGGCTGG - Intronic