ID: 1042217289

View in Genome Browser
Species Human (GRCh38)
Location 8:66439111-66439133
Sequence ACGCGGGGGCGAGTGAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042217289_1042217294 14 Left 1042217289 8:66439111-66439133 CCAGCTCTCACTCGCCCCCGCGT No data
Right 1042217294 8:66439148-66439170 CAGTTCGAATTTTTGAGATCTGG No data
1042217289_1042217295 18 Left 1042217289 8:66439111-66439133 CCAGCTCTCACTCGCCCCCGCGT No data
Right 1042217295 8:66439152-66439174 TCGAATTTTTGAGATCTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042217289 Original CRISPR ACGCGGGGGCGAGTGAGAGC TGG (reversed) Intronic